Incidental Mutation 'R0853:Cfh'
ID82602
Institutional Source Beutler Lab
Gene Symbol Cfh
Ensembl Gene ENSMUSG00000026365
Gene Namecomplement component factor h
SynonymsMud-1, Sas1, Sas-1
MMRRC Submission 039032-MU
Accession Numbers

Genbank: NM_009888; MGI: 88385

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R0853 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location140084708-140183764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140105490 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 772 (H772L)
Ref Sequence ENSEMBL: ENSMUSP00000115166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066859] [ENSMUST00000111976] [ENSMUST00000111977] [ENSMUST00000123238] [ENSMUST00000192880]
Predicted Effect probably damaging
Transcript: ENSMUST00000066859
AA Change: H772L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066677
Gene: ENSMUSG00000026365
AA Change: H772L

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
CCP 1114 1168 8.04e-15 SMART
CCP 1172 1233 5.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111976
AA Change: H790L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107607
Gene: ENSMUSG00000026365
AA Change: H790L

DomainStartEndE-ValueType
CCP 39 98 7.75e-8 SMART
CCP 103 159 2.17e-11 SMART
CCP 164 223 7.5e-15 SMART
CCP 228 280 6.29e-8 SMART
CCP 285 338 2.04e-7 SMART
CCP 343 403 6.35e-4 SMART
CCP 407 460 1.15e-10 SMART
CCP 466 523 3.62e-8 SMART
CCP 527 582 6.45e-5 SMART
CCP 587 640 5.56e-9 SMART
CCP 647 701 3.45e-14 SMART
CCP 708 761 1.82e-13 SMART
CCP 770 820 6.59e-1 SMART
CCP 826 879 1.04e-8 SMART
CCP 885 949 4.66e-11 SMART
CCP 954 1007 3.9e-13 SMART
CCP 1012 1066 1.4e-14 SMART
CCP 1071 1125 2.09e-13 SMART
CCP 1132 1186 8.04e-15 SMART
CCP 1190 1251 5.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111977
AA Change: H733L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107608
Gene: ENSMUSG00000026365
AA Change: H733L

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 572 626 3.45e-14 SMART
CCP 633 686 1.82e-13 SMART
CCP 695 745 6.59e-1 SMART
CCP 751 804 1.04e-8 SMART
CCP 810 874 4.66e-11 SMART
CCP 879 932 3.9e-13 SMART
CCP 937 991 1.4e-14 SMART
CCP 996 1050 2.09e-13 SMART
CCP 1057 1111 8.04e-15 SMART
CCP 1115 1176 5.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123238
AA Change: H772L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115166
Gene: ENSMUSG00000026365
AA Change: H772L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192880
SMART Domains Protein: ENSMUSP00000141209
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CCP 39 98 3.9e-10 SMART
CCP 103 159 1e-13 SMART
CCP 164 223 3.7e-17 SMART
CCP 228 280 3.1e-10 SMART
CCP 285 338 9.9e-10 SMART
CCP 343 403 3.2e-6 SMART
CCP 407 460 5.6e-13 SMART
CCP 467 521 6.7e-17 SMART
CCP 526 580 1e-15 SMART
CCP 587 641 3.8e-17 SMART
CCP 645 706 2.7e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192919
AA Change: H503L
Meta Mutation Damage Score 0.4108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.9%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene results in markedly reduced serum C3, abnormal renal histology, spontaneous membranoproliferative glomerulonephritis (MPGN), hematuria, proteinuria, and increased mortality at 8 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 G T 9: 14,592,778 P378Q probably damaging Het
Angpt4 A G 2: 151,938,927 E365G probably damaging Het
Asb6 G A 2: 30,827,030 P61L possibly damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atxn7 C A 14: 14,089,465 probably benign Het
Cacul1 A T 19: 60,534,226 I290N probably damaging Het
Ccser2 A C 14: 36,940,410 S272R probably benign Het
Cldn6 T G 17: 23,681,464 I134S probably damaging Het
Col3a1 T A 1: 45,343,324 probably benign Het
Fam118a T C 15: 85,048,525 F156S possibly damaging Het
Fgd4 T A 16: 16,474,387 probably benign Het
Gckr G C 5: 31,305,048 A242P probably damaging Het
Gcnt4 A G 13: 96,946,835 D213G probably damaging Het
Gm21994 A T 2: 150,255,478 S38R probably benign Het
Hace1 T A 10: 45,648,683 V237E probably damaging Het
Herc3 T C 6: 58,876,564 L570P probably damaging Het
Hk1 T A 10: 62,271,716 K827* probably null Het
Hyal6 T C 6: 24,734,073 F2L probably benign Het
Jak2 C A 19: 29,284,926 Y382* probably null Het
Kat8 C T 7: 127,925,224 H425Y probably benign Het
Kcnj3 T C 2: 55,437,223 F8S possibly damaging Het
Klk1 T A 7: 44,221,498 probably benign Het
Klra8 T C 6: 130,119,014 Y205C probably damaging Het
Kpnb1 T C 11: 97,187,411 E26G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nphp3 T C 9: 104,031,933 S781P probably benign Het
Nqo2 A T 13: 33,979,577 H73L probably benign Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pah G A 10: 87,576,218 probably null Het
Pcdhb4 T G 18: 37,309,885 Y749* probably null Het
Pdgfrb C A 18: 61,080,327 N914K probably damaging Het
Ralyl A G 3: 13,946,506 Y4C probably damaging Het
Rapgef6 T A 11: 54,668,677 I1052N probably damaging Het
Sdk2 G A 11: 113,821,415 T1642I probably benign Het
Siglec1 G A 2: 131,085,022 T207M probably damaging Het
Taf1b T C 12: 24,514,828 L148P probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Tdp1 G A 12: 99,935,067 R536H probably damaging Het
Tubgcp5 T A 7: 55,814,851 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r58 G T 7: 5,410,325 T302K probably damaging Het
Other mutations in Cfh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cfh APN 1 140088682 missense probably damaging 1.00
IGL01124:Cfh APN 1 140183261 missense probably benign 0.01
IGL01389:Cfh APN 1 140154639 missense probably benign 0.44
IGL01455:Cfh APN 1 140105539 missense possibly damaging 0.51
IGL01877:Cfh APN 1 140100829 missense probably damaging 1.00
IGL02836:Cfh APN 1 140102399 missense probably damaging 1.00
IGL02937:Cfh APN 1 140105442 missense probably benign 0.19
IGL03039:Cfh APN 1 140136261 missense possibly damaging 0.86
IGL03069:Cfh APN 1 140099055 intron probably benign
IGL03192:Cfh APN 1 140099021 missense possibly damaging 0.71
IGL03201:Cfh APN 1 140102819 missense probably damaging 1.00
3-1:Cfh UTSW 1 140163125 missense probably damaging 1.00
PIT4449001:Cfh UTSW 1 140112565 missense probably damaging 1.00
R0257:Cfh UTSW 1 140144035 missense probably benign 0.01
R0294:Cfh UTSW 1 140183261 missense probably benign 0.01
R0571:Cfh UTSW 1 140102333 splice site probably null
R0576:Cfh UTSW 1 140136815 missense probably damaging 0.99
R0586:Cfh UTSW 1 140183182 missense probably damaging 0.98
R0605:Cfh UTSW 1 140102358 missense probably damaging 1.00
R0617:Cfh UTSW 1 140100883 missense probably benign 0.01
R0725:Cfh UTSW 1 140157343 splice site probably benign
R1430:Cfh UTSW 1 140102698 splice site probably benign
R1500:Cfh UTSW 1 140100876 missense probably damaging 1.00
R1533:Cfh UTSW 1 140100978 missense possibly damaging 0.86
R1667:Cfh UTSW 1 140105523 missense probably benign 0.01
R1695:Cfh UTSW 1 140102837 missense probably damaging 0.98
R1728:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1729:Cfh UTSW 1 140136788 missense probably benign 0.02
R1729:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1730:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1739:Cfh UTSW 1 140136788 missense probably benign 0.02
R1739:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1756:Cfh UTSW 1 140100877 missense probably damaging 1.00
R1762:Cfh UTSW 1 140136788 missense probably benign 0.02
R1762:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1783:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1784:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1785:Cfh UTSW 1 140136788 missense probably benign 0.02
R1785:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1912:Cfh UTSW 1 140136141 splice site probably null
R2273:Cfh UTSW 1 140102825 missense probably damaging 1.00
R2288:Cfh UTSW 1 140098901 missense possibly damaging 0.70
R3725:Cfh UTSW 1 140086496 missense probably damaging 0.99
R3731:Cfh UTSW 1 140119970 missense possibly damaging 0.71
R4060:Cfh UTSW 1 140119926 missense possibly damaging 0.91
R4192:Cfh UTSW 1 140102716 missense possibly damaging 0.50
R4226:Cfh UTSW 1 140108926 missense probably damaging 1.00
R4425:Cfh UTSW 1 140100875 nonsense probably null
R4431:Cfh UTSW 1 140136266 missense probably damaging 1.00
R4712:Cfh UTSW 1 140108536 missense probably damaging 1.00
R4755:Cfh UTSW 1 140088808 missense probably damaging 1.00
R4792:Cfh UTSW 1 140100823 nonsense probably null
R4831:Cfh UTSW 1 140086387 missense probably benign
R5052:Cfh UTSW 1 140144044 missense probably damaging 0.96
R5181:Cfh UTSW 1 140147646 splice site probably benign
R5205:Cfh UTSW 1 140143970 missense probably damaging 1.00
R5285:Cfh UTSW 1 140100898 missense probably benign 0.21
R5366:Cfh UTSW 1 140136235 missense probably damaging 1.00
R5776:Cfh UTSW 1 140144023 missense possibly damaging 0.83
R5914:Cfh UTSW 1 140136229 missense probably benign 0.39
R5948:Cfh UTSW 1 140108808 missense probably damaging 0.96
R5979:Cfh UTSW 1 140118671 missense possibly damaging 0.66
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6059:Cfh UTSW 1 140118690 missense possibly damaging 0.92
R6198:Cfh UTSW 1 140105440 missense probably damaging 1.00
R6306:Cfh UTSW 1 140102417 missense probably damaging 1.00
R6523:Cfh UTSW 1 140101707 missense possibly damaging 0.82
R6610:Cfh UTSW 1 140101748 nonsense probably null
R6652:Cfh UTSW 1 140144068 missense probably benign 0.39
R6852:Cfh UTSW 1 140147749 missense probably damaging 1.00
R6861:Cfh UTSW 1 140100883 missense probably benign 0.07
R6862:Cfh UTSW 1 140102362 missense probably damaging 1.00
R7065:Cfh UTSW 1 140086402 missense probably damaging 0.99
R7191:Cfh UTSW 1 140112567 missense probably benign 0.04
R7197:Cfh UTSW 1 140088767 nonsense probably null
R7355:Cfh UTSW 1 140136815 missense probably damaging 1.00
R7367:Cfh UTSW 1 140086521 missense probably damaging 0.97
R7419:Cfh UTSW 1 140105466 missense probably damaging 0.99
R7579:Cfh UTSW 1 140108590 missense possibly damaging 0.53
R7586:Cfh UTSW 1 140147721 missense probably damaging 0.99
R8119:Cfh UTSW 1 140120015 missense possibly damaging 0.95
T0975:Cfh UTSW 1 140154598 missense probably benign 0.05
Z1088:Cfh UTSW 1 140108904 missense probably benign 0.04
Z1088:Cfh UTSW 1 140147718 missense possibly damaging 0.77
Z1177:Cfh UTSW 1 140144059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACCATATGACACATAGGTAAAGCCA -3'
(R):5'- ACTTCTGCACAGTGAATCTCAGCATTTT -3'

Sequencing Primer
(F):5'- gccaactaataagttatccaatccc -3'
(R):5'- AATCTCAGCATTTTGGTTGGCAG -3'
Posted On2013-11-08