Incidental Mutation 'R3789:Hltf'
ID 272424
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Name helicase-like transcription factor
Synonyms P113, Snf2l3, Smarca3
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3789 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 20057811-20118490 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20069047 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 200 (P200S)
Ref Sequence ENSEMBL: ENSMUSP00000118775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
AlphaFold Q6PCN7
Predicted Effect probably benign
Transcript: ENSMUST00000002502
AA Change: P262S

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: P262S

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect probably damaging
Transcript: ENSMUST00000143005
AA Change: P262S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428
AA Change: P262S

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145853
AA Change: P200S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428
AA Change: P200S

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154233
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20105632 splice site probably benign
IGL01461:Hltf APN 3 20099939 nonsense probably null
IGL01630:Hltf APN 3 20082904 splice site probably benign
IGL01704:Hltf APN 3 20083746 splice site probably benign
IGL02059:Hltf APN 3 20106457 missense probably benign
IGL02105:Hltf APN 3 20092757 missense probably damaging 1.00
IGL02156:Hltf APN 3 20092807 missense possibly damaging 0.61
IGL02870:Hltf APN 3 20099873 missense probably damaging 0.98
IGL02899:Hltf APN 3 20099817 missense probably damaging 1.00
IGL02935:Hltf APN 3 20069051 missense probably damaging 1.00
IGL02950:Hltf APN 3 20076572 missense probably benign 0.07
IGL03082:Hltf APN 3 20064559 splice site probably benign
snarky UTSW 3 20109487 critical splice donor site probably null
R0068:Hltf UTSW 3 20059090 missense probably damaging 1.00
R0787:Hltf UTSW 3 20106446 missense probably damaging 1.00
R0905:Hltf UTSW 3 20108869 critical splice donor site probably null
R0980:Hltf UTSW 3 20091501 missense probably benign 0.00
R1741:Hltf UTSW 3 20086188 missense probably damaging 1.00
R1748:Hltf UTSW 3 20076521 missense probably benign 0.13
R1799:Hltf UTSW 3 20105691 missense probably damaging 1.00
R1976:Hltf UTSW 3 20106446 missense probably damaging 1.00
R2171:Hltf UTSW 3 20059081 missense probably damaging 1.00
R2395:Hltf UTSW 3 20092742 missense probably benign 0.41
R2444:Hltf UTSW 3 20063907 missense possibly damaging 0.66
R3943:Hltf UTSW 3 20092744 missense probably damaging 1.00
R4719:Hltf UTSW 3 20064701 critical splice donor site probably null
R4793:Hltf UTSW 3 20063950 missense possibly damaging 0.79
R5296:Hltf UTSW 3 20108112 missense probably damaging 0.99
R5449:Hltf UTSW 3 20069083 missense possibly damaging 0.92
R5492:Hltf UTSW 3 20098067 splice site probably null
R6012:Hltf UTSW 3 20058934 missense probably damaging 1.00
R6157:Hltf UTSW 3 20076496 missense probably benign 0.13
R6254:Hltf UTSW 3 20063829 missense possibly damaging 0.85
R6553:Hltf UTSW 3 20072394 missense probably damaging 0.96
R6616:Hltf UTSW 3 20109487 critical splice donor site probably null
R6696:Hltf UTSW 3 20065306 splice site probably null
R6761:Hltf UTSW 3 20083832 critical splice donor site probably null
R6781:Hltf UTSW 3 20098166 missense probably benign 0.00
R7241:Hltf UTSW 3 20065392 missense probably benign 0.07
R7356:Hltf UTSW 3 20109370 missense probably damaging 1.00
R7453:Hltf UTSW 3 20082752 missense possibly damaging 0.81
R7765:Hltf UTSW 3 20091483 missense probably benign 0.02
R7978:Hltf UTSW 3 20092804 missense probably damaging 1.00
R8299:Hltf UTSW 3 20082822 missense possibly damaging 0.73
R8547:Hltf UTSW 3 20098127 missense probably damaging 1.00
R8857:Hltf UTSW 3 20105661 missense probably damaging 0.98
R8859:Hltf UTSW 3 20065402 nonsense probably null
R8926:Hltf UTSW 3 20069159 critical splice donor site probably null
R8959:Hltf UTSW 3 20082772 missense probably damaging 1.00
R9052:Hltf UTSW 3 20098082 missense probably damaging 1.00
R9214:Hltf UTSW 3 20086116 missense probably benign 0.01
R9405:Hltf UTSW 3 20082930 missense possibly damaging 0.88
X0027:Hltf UTSW 3 20067389 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTTCAGCATTGTCAACTGCC -3'
(R):5'- AAGCTGATACCCTTCTTTCAGC -3'

Sequencing Primer
(F):5'- TGTCAACTGCCTTGGTAATTTATAC -3'
(R):5'- CATCCGCTAAAATTCCTCC -3'
Posted On 2015-03-25