Mutagenetix > Incidental Mutations

Incidental Mutation 'R0068:Hltf'

64409

Institutional Source

Beutler Lab

Gene Symbol

Hltf

Ensembl Gene

ENSMUSG00000002428

Gene Name

helicase-like transcription factor

Synonyms

P113, Snf2l3, Smarca3

MMRRC Submission

038359-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0068 (G1)

Quality Score

140

Status

Validated

Chromosome

Chromosomal Location

20057811-20118490 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 20059090 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 9 (R9H)

Ref Sequence

ENSEMBL: ENSMUSP00000118775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]

Predicted Effect

probably benign
Transcript: ENSMUST00000002502
AA Change: R71H

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: R71H

Domain	Start	End	E-Value	Type
HIRAN	60	154	3.78e-29	SMART
DEXDc	236	608	1.26e-32	SMART
RING	754	794	4.41e-6	SMART
low complexity region	814	828	N/A	INTRINSIC
HELICc	859	944	2.24e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128127

Predicted Effect

possibly damaging
Transcript: ENSMUST00000143005
AA Change: R71H

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428
AA Change: R71H

Domain	Start	End	E-Value	Type
HIRAN	60	154	3.78e-29	SMART
DEXDc	236	610	2.36e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000145853
AA Change: R9H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428
AA Change: R9H

Domain	Start	End	E-Value	Type
HIRAN	1	92	2.7e-25	SMART
DEXDc	174	548	2.36e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154233

Meta Mutation Damage Score

0.5104

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 92.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,952,221	T1675A	probably benign	Het
Abca6	T	C	11: 110,182,882	T1448A	probably damaging	Het
Aldoart2	G	T	12: 55,565,448	E53*	probably null	Het
Ankra2	C	T	13: 98,273,383	Q137*	probably null	Het
Arpc1a	C	T	5: 145,091,244	T21I	possibly damaging	Het
Arvcf	T	C	16: 18,396,954		probably benign	Het
Ash1l	C	A	3: 89,007,317	S1751R	probably benign	Het
Bsn	C	A	9: 108,112,137	G2139C	probably damaging	Het
Ccdc148	T	C	2: 58,827,617	E530G	probably benign	Het
Cct3	A	G	3: 88,318,465	D365G	probably benign	Het
Chd2	A	T	7: 73,484,534	S688R	probably damaging	Het
Crispld1	A	G	1: 17,752,988	T398A	possibly damaging	Het
Ctbp2	A	C	7: 132,990,059	V906G	possibly damaging	Het
Cwf19l1	A	T	19: 44,131,499	Y68N	probably damaging	Het
Dlc1	T	A	8: 36,937,721	M305L	probably benign	Het
Dnm1l	C	A	16: 16,324,019	G288C	probably damaging	Het
Fignl2	A	T	15: 101,054,248	I51N	probably damaging	Het
Flnb	A	G	14: 7,915,290	N1474D	possibly damaging	Het
Ghrhr	C	T	6: 55,380,864		probably benign	Het
Gm11639	T	C	11: 104,720,822	S497P	probably benign	Het
Hps5	A	G	7: 46,777,042		probably benign	Het
Itpr3	T	C	17: 27,104,060		probably benign	Het
Kansl1l	A	G	1: 66,720,888	V911A	probably benign	Het
Kdm3b	C	T	18: 34,824,774	T1064I	probably benign	Het
Lrriq1	T	A	10: 103,063,418	Q1654L	probably benign	Het
Ltbp1	A	G	17: 75,359,409	T1366A	probably damaging	Het
Mroh1	A	G	15: 76,446,692		probably benign	Het
Mroh2a	GT	GTT	1: 88,256,166		probably null	Het
Napb	G	A	2: 148,698,923		probably benign	Het
Npc1	G	C	18: 12,208,367	P532A	probably benign	Het
Nrp2	G	T	1: 62,745,377	K228N	possibly damaging	Het
Olfr275	T	A	4: 52,825,503	Y35*	probably null	Het
Plekhg1	A	T	10: 3,940,504	K241*	probably null	Het
Poln	T	C	5: 34,077,088		probably benign	Het
Ppil1	A	T	17: 29,252,256	F92I	probably damaging	Het
Ppp1r9b	T	G	11: 95,001,220	F154V	probably damaging	Het
Ptchd3	T	G	11: 121,842,972	L896R	probably damaging	Het
Rev3l	A	G	10: 39,824,831	N1775D	possibly damaging	Het
Rusc2	T	C	4: 43,424,100		probably benign	Het
Selenbp2	T	C	3: 94,703,509	V294A	probably benign	Het
Slc25a48	T	C	13: 56,451,211	V118A	probably damaging	Het
Slc38a10	T	C	11: 120,134,853	D219G	probably damaging	Het
Slc38a2	C	T	15: 96,691,292		probably null	Het
Slc39a12	A	G	2: 14,435,678	E480G	probably benign	Het
Tab2	C	A	10: 7,919,677	R347L	probably damaging	Het
Tas2r123	T	C	6: 132,847,992	I284T	possibly damaging	Het
Tnks1bp1	T	A	2: 85,062,352	D212E	probably benign	Het
Trim67	T	C	8: 124,794,568	V223A	probably damaging	Het
Ugcg	A	G	4: 59,217,130	D218G	probably benign	Het
Vmn2r59	A	G	7: 42,046,301	L229S	probably damaging	Het
Zfp451	A	T	1: 33,777,625	L198I	probably damaging	Het

Other mutations in Hltf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Hltf	APN	3	20105632	splice site	probably benign
IGL01461:Hltf	APN	3	20099939	nonsense	probably null
IGL01630:Hltf	APN	3	20082904	splice site	probably benign
IGL01704:Hltf	APN	3	20083746	splice site	probably benign
IGL02059:Hltf	APN	3	20106457	missense	probably benign
IGL02105:Hltf	APN	3	20092757	missense	probably damaging	1.00
IGL02156:Hltf	APN	3	20092807	missense	possibly damaging	0.61
IGL02870:Hltf	APN	3	20099873	missense	probably damaging	0.98
IGL02899:Hltf	APN	3	20099817	missense	probably damaging	1.00
IGL02935:Hltf	APN	3	20069051	missense	probably damaging	1.00
IGL02950:Hltf	APN	3	20076572	missense	probably benign	0.07
IGL03082:Hltf	APN	3	20064559	splice site	probably benign
snarky	UTSW	3	20109487	critical splice donor site	probably null
R0787:Hltf	UTSW	3	20106446	missense	probably damaging	1.00
R0905:Hltf	UTSW	3	20108869	critical splice donor site	probably null
R0980:Hltf	UTSW	3	20091501	missense	probably benign	0.00
R1741:Hltf	UTSW	3	20086188	missense	probably damaging	1.00
R1748:Hltf	UTSW	3	20076521	missense	probably benign	0.13
R1799:Hltf	UTSW	3	20105691	missense	probably damaging	1.00
R1976:Hltf	UTSW	3	20106446	missense	probably damaging	1.00
R2171:Hltf	UTSW	3	20059081	missense	probably damaging	1.00
R2395:Hltf	UTSW	3	20092742	missense	probably benign	0.41
R2444:Hltf	UTSW	3	20063907	missense	possibly damaging	0.66
R3789:Hltf	UTSW	3	20069047	missense	probably damaging	1.00
R3943:Hltf	UTSW	3	20092744	missense	probably damaging	1.00
R4719:Hltf	UTSW	3	20064701	critical splice donor site	probably null
R4793:Hltf	UTSW	3	20063950	missense	possibly damaging	0.79
R5296:Hltf	UTSW	3	20108112	missense	probably damaging	0.99
R5449:Hltf	UTSW	3	20069083	missense	possibly damaging	0.92
R5492:Hltf	UTSW	3	20098067	splice site	probably null
R6012:Hltf	UTSW	3	20058934	missense	probably damaging	1.00
R6157:Hltf	UTSW	3	20076496	missense	probably benign	0.13
R6254:Hltf	UTSW	3	20063829	missense	possibly damaging	0.85
R6553:Hltf	UTSW	3	20072394	missense	probably damaging	0.96
R6616:Hltf	UTSW	3	20109487	critical splice donor site	probably null
R6696:Hltf	UTSW	3	20065306	intron	probably null
R6761:Hltf	UTSW	3	20083832	critical splice donor site	probably null
R6781:Hltf	UTSW	3	20098166	missense	probably benign	0.00
R7241:Hltf	UTSW	3	20065392	missense	probably benign	0.07
R7356:Hltf	UTSW	3	20109370	missense	probably damaging	1.00
R7453:Hltf	UTSW	3	20082752	missense	possibly damaging	0.81
R7765:Hltf	UTSW	3	20091483	missense	probably benign	0.02
X0027:Hltf	UTSW	3	20067389	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGGAAGTATTCGCAGTCTGTCCAGT -3'
(R):5'- TCACAAGGACCAAATGTGTGGGCAA -3'

Sequencing Primer
(F):5'- TGTCCAGTATGGATCACACG -3'
(R):5'- CCAAATGTGTGGGCAAAAGTG -3'

Posted On

2013-08-06