Incidental Mutation 'R0898:Sox11'
ID83760
Institutional Source Beutler Lab
Gene Symbol Sox11
Ensembl Gene ENSMUSG00000063632
Gene NameSRY (sex determining region Y)-box 11
Synonyms6230403H02Rik, 1110038H03Rik, end1
MMRRC Submission 039058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0898 (G1)
Quality Score214
Status Validated
Chromosome12
Chromosomal Location27334264-27342574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27341225 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 395 (Y395C)
Ref Sequence ENSEMBL: ENSMUSP00000078070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079063]
Predicted Effect probably damaging
Transcript: ENSMUST00000079063
AA Change: Y395C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078070
Gene: ENSMUSG00000063632
AA Change: Y395C

DomainStartEndE-ValueType
HMG 48 118 1.35e-27 SMART
low complexity region 142 174 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
low complexity region 207 213 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 281 309 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
Meta Mutation Damage Score 0.6107 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may function in the developing nervous system and play a role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality with impaired ossification and impaired development of the heart, lung, spleen, stomach, skeleton and pancreas. Mice homozygous for a different knock-out allele exhibit abnormal nervous system development and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 T A 1: 134,424,076 probably null Het
Apmap A G 2: 150,585,749 probably benign Het
Arhgap11a T C 2: 113,836,876 N442S probably benign Het
Bpifb5 C T 2: 154,233,334 A394V probably benign Het
Brpf3 A G 17: 28,806,990 T346A possibly damaging Het
Ccdc154 A G 17: 25,164,081 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Col3a1 T C 1: 45,333,993 probably benign Het
Cpm A C 10: 117,676,106 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Ddx59 T C 1: 136,416,941 Y117H probably damaging Het
Fam241b A G 10: 62,108,994 F98L probably damaging Het
Fmn2 G A 1: 174,503,460 G472E unknown Het
Gcdh T C 8: 84,893,560 H41R possibly damaging Het
Gm7713 A C 15: 59,994,441 noncoding transcript Het
Gmeb1 T C 4: 132,234,782 T189A probably benign Het
Iqck G A 7: 118,971,441 C272Y probably damaging Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Map3k1 T C 13: 111,767,956 probably benign Het
Nabp1 T C 1: 51,471,337 I169V probably benign Het
Olfr761 T C 17: 37,952,236 T263A probably benign Het
Olfr898 G A 9: 38,349,442 V120M probably damaging Het
Pfkm A G 15: 98,128,230 I569V probably benign Het
Plcb1 A T 2: 135,387,143 T1096S possibly damaging Het
Plscr4 A C 9: 92,484,753 D140A probably damaging Het
Plxna2 A G 1: 194,797,024 D1331G probably damaging Het
Ppfia4 T C 1: 134,321,126 T498A probably benign Het
Prkar2b A T 12: 31,963,002 L372I possibly damaging Het
Rslcan18 T C 13: 67,098,816 N120S probably benign Het
Sbf2 C T 7: 110,371,652 V846I possibly damaging Het
Slc16a7 A G 10: 125,233,501 I102T possibly damaging Het
Slc1a4 T C 11: 20,304,349 T506A probably damaging Het
Slc22a7 T C 17: 46,433,149 T462A probably damaging Het
Taf2 T C 15: 55,060,084 T266A probably damaging Het
Tanc1 C T 2: 59,790,788 T317I probably damaging Het
Tnxb T C 17: 34,670,745 S71P probably damaging Het
Tpgs2 G A 18: 25,149,150 P115S probably damaging Het
Trmt10a C T 3: 138,149,518 P139L probably damaging Het
Zfp113 T C 5: 138,144,789 S400G probably benign Het
Other mutations in Sox11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1265:Sox11 UTSW 12 27341736 missense probably benign 0.03
R2073:Sox11 UTSW 12 27342279 missense possibly damaging 0.91
R2108:Sox11 UTSW 12 27341703 missense probably damaging 1.00
R3620:Sox11 UTSW 12 27341736 missense probably benign 0.03
R3855:Sox11 UTSW 12 27341502 missense probably damaging 0.99
R5681:Sox11 UTSW 12 27341824 missense probably benign
R6288:Sox11 UTSW 12 27342333 missense possibly damaging 0.85
R6933:Sox11 UTSW 12 27341494 missense probably damaging 0.99
R7752:Sox11 UTSW 12 27341440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAACTCCAGACTAGGTGTGCAAC -3'
(R):5'- AGCTTGAATTTCTCCCAGGGCG -3'

Sequencing Primer
(F):5'- CTAGGTGTGCAACTACCTTGAGAC -3'
(R):5'- TGGTGGATAAGGACCTGGAT -3'
Posted On2013-11-08