Incidental Mutation 'R1256:Ccdc186'
ID151479
Institutional Source Beutler Lab
Gene Symbol Ccdc186
Ensembl Gene ENSMUSG00000035173
Gene Namecoiled-coil domain containing 186
SynonymsOtg1, A630007B06Rik, 1810028B20Rik
MMRRC Submission 039323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R1256 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location56787481-56822190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56797621 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 661 (L661I)
Ref Sequence ENSEMBL: ENSMUSP00000113457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076085] [ENSMUST00000118592]
Predicted Effect probably benign
Transcript: ENSMUST00000076085
AA Change: L661I

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075454
Gene: ENSMUSG00000035173
AA Change: L661I

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118592
AA Change: L661I

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113457
Gene: ENSMUSG00000035173
AA Change: L661I

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135666
SMART Domains Protein: ENSMUSP00000122539
Gene: ENSMUSG00000035173

DomainStartEndE-ValueType
Blast:SPEC 2 75 2e-15 BLAST
coiled coil region 149 188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156708
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Apaf1 A G 10: 91,058,406 Y456H probably benign Het
Arhgef11 A G 3: 87,727,135 N791S possibly damaging Het
Brat1 A G 5: 140,710,207 Q66R possibly damaging Het
Capn10 C T 1: 92,946,946 T633M probably damaging Het
Cln3 A G 7: 126,583,036 S4P probably damaging Het
Cnot10 G T 9: 114,610,681 S520Y probably damaging Het
Csmd1 A T 8: 16,079,964 F1715I probably damaging Het
Dscr3 A G 16: 94,512,366 L22P probably damaging Het
Ezh2 A T 6: 47,541,855 C545* probably null Het
Hivep1 C T 13: 42,181,831 S2282F probably damaging Het
Jag2 T C 12: 112,914,419 E564G possibly damaging Het
Kcnj16 A G 11: 111,025,436 H308R probably damaging Het
Kdelc2 A C 9: 53,388,462 R90S possibly damaging Het
Magi3 C T 3: 104,027,810 V936I probably benign Het
Mcu G T 10: 59,454,968 A279E probably damaging Het
Msln A G 17: 25,754,183 C13R probably damaging Het
Nes A G 3: 87,976,576 D714G probably benign Het
Nif3l1 T A 1: 58,455,649 V259D probably damaging Het
Olfr1262 A T 2: 90,002,567 M54L possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr177 A C 16: 58,872,843 Y102* probably null Het
Pcdhb9 A G 18: 37,403,116 D721G possibly damaging Het
Pepd A C 7: 34,921,492 T61P possibly damaging Het
Pkd1l2 C T 8: 117,019,543 probably null Het
Psip1 A G 4: 83,474,367 S102P probably benign Het
Ralgapa1 T C 12: 55,762,661 E443G possibly damaging Het
Rnf20 A G 4: 49,638,230 D114G probably benign Het
Schip1 A T 3: 68,495,042 I151F probably benign Het
Smarca2 A G 19: 26,681,973 I888V probably benign Het
Smg1 T C 7: 118,203,087 T263A probably damaging Het
Spn T C 7: 127,136,273 K354R possibly damaging Het
Sspo G A 6: 48,457,639 A1022T probably damaging Het
Strn A C 17: 78,664,617 probably null Het
Tstd3 T C 4: 21,759,627 I79M probably damaging Het
Txnl4a A G 18: 80,207,272 I28V probably benign Het
Uty T C Y: 1,134,884 D928G probably damaging Het
Vsx2 T A 12: 84,576,311 L163Q probably damaging Het
Other mutations in Ccdc186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Ccdc186 APN 19 56813447 missense probably benign 0.18
IGL00976:Ccdc186 APN 19 56797500 missense probably damaging 1.00
IGL01146:Ccdc186 APN 19 56809317 missense probably damaging 1.00
IGL01316:Ccdc186 APN 19 56813413 missense probably benign 0.01
IGL01627:Ccdc186 APN 19 56792020 missense probably damaging 1.00
IGL02325:Ccdc186 APN 19 56813356 missense probably benign 0.03
IGL02755:Ccdc186 APN 19 56813396 missense probably benign 0.06
IGL02899:Ccdc186 APN 19 56793488 missense probably benign 0.00
IGL03408:Ccdc186 APN 19 56798731 missense probably benign 0.00
receding UTSW 19 56800129 missense probably damaging 1.00
R1728:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1729:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1784:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1813:Ccdc186 UTSW 19 56800169 missense probably benign 0.03
R1909:Ccdc186 UTSW 19 56793361 missense probably damaging 1.00
R2110:Ccdc186 UTSW 19 56800142 missense possibly damaging 0.80
R2319:Ccdc186 UTSW 19 56797567 missense possibly damaging 0.50
R2351:Ccdc186 UTSW 19 56798697 missense possibly damaging 0.89
R2970:Ccdc186 UTSW 19 56806998 missense probably damaging 1.00
R4159:Ccdc186 UTSW 19 56793492 nonsense probably null
R4898:Ccdc186 UTSW 19 56802000 splice site probably null
R4910:Ccdc186 UTSW 19 56798691 missense probably damaging 0.98
R5325:Ccdc186 UTSW 19 56813181 missense probably damaging 0.99
R5338:Ccdc186 UTSW 19 56813257 missense possibly damaging 0.87
R5662:Ccdc186 UTSW 19 56793488 missense probably benign
R5773:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6621:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6806:Ccdc186 UTSW 19 56800129 missense probably damaging 1.00
R6908:Ccdc186 UTSW 19 56791939 critical splice donor site probably null
R6977:Ccdc186 UTSW 19 56798787 missense probably benign 0.05
R7108:Ccdc186 UTSW 19 56798760 missense not run
Predicted Primers PCR Primer
(F):5'- ACCTTGCTGAAGCTGCTTGCTG -3'
(R):5'- CCTGACTGGAGTCACAACATTCAGAG -3'

Sequencing Primer
(F):5'- AAGCTGCTTGCTGAGGTCC -3'
(R):5'- CATTCAGAGACTTAGATTGCAGC -3'
Posted On2014-01-29