Incidental Mutation 'R1759:Myo5a'
ID195200
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Namemyosin VA
Synonyms9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission 039791-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location75071015-75223688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75181993 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1135 (D1135G)
Ref Sequence ENSEMBL: ENSMUSP00000116028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000129281] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]
PDB Structure
Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000123128
AA Change: D1135G

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: D1135G

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129281
SMART Domains Protein: ENSMUSP00000118881
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
coiled coil region 1 27 N/A INTRINSIC
coiled coil region 129 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130384
SMART Domains Protein: ENSMUSP00000114803
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
coiled coil region 95 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136604
Predicted Effect probably benign
Transcript: ENSMUST00000136731
AA Change: D1135G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: D1135G

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148144
SMART Domains Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
coiled coil region 71 175 N/A INTRINSIC
Blast:DIL 275 305 4e-13 BLAST
Blast:DIL 330 355 5e-6 BLAST
DIL 417 522 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149032
Predicted Effect probably benign
Transcript: ENSMUST00000155282
AA Change: D1135G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: D1135G

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 unclassified probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTTAGCCACCAGTGCAAATCAC -3'
(R):5'- GCAGAAACTTCTGAGGGATACAGCC -3'

Sequencing Primer
(F):5'- GTGCAAATCACTGAGTGAAGATTAC -3'
(R):5'- tggcagagcacatgcttac -3'
Posted On2014-05-23