Incidental Mutation 'R0060:Olfr1105'
ID201398
Institutional Source Beutler Lab
Gene Symbol Olfr1105
Ensembl Gene ENSMUSG00000075165
Gene Nameolfactory receptor 1105
SynonymsMOR172-7, MOR0-6P, GA_x6K02T2Q125-48521031-48520093
MMRRC Submission 038353-MU
Accession Numbers

Genbank: NM_001011825; MGI: 3030939

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0060 (G1)
Quality Score35
Status Validated
Chromosome2
Chromosomal Location87031260-87036531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87033774 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 149 (Y149C)
Ref Sequence ENSEMBL: ENSMUSP00000149148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099868] [ENSMUST00000215978]
Predicted Effect probably damaging
Transcript: ENSMUST00000099868
AA Change: Y149C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097453
Gene: ENSMUSG00000075165
AA Change: Y149C

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 5.2e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.5e-6 PFAM
Pfam:7tm_1 41 308 5.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215978
AA Change: Y149C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Olfr1105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01673:Olfr1105 APN 2 87033387 missense probably damaging 1.00
IGL02029:Olfr1105 APN 2 87033901 missense probably benign 0.00
IGL02332:Olfr1105 APN 2 87034212 missense probably benign 0.32
3-1:Olfr1105 UTSW 2 87033684 missense probably damaging 1.00
R0060:Olfr1105 UTSW 2 87033774 missense probably damaging 1.00
R0100:Olfr1105 UTSW 2 87033595 missense probably benign 0.01
R0100:Olfr1105 UTSW 2 87033595 missense probably benign 0.01
R0417:Olfr1105 UTSW 2 87033445 missense probably damaging 0.99
R0573:Olfr1105 UTSW 2 87033468 missense probably damaging 1.00
R0589:Olfr1105 UTSW 2 87034115 nonsense probably null
R0630:Olfr1105 UTSW 2 87033309 missense probably benign 0.05
R0690:Olfr1105 UTSW 2 87033882 missense probably damaging 1.00
R3929:Olfr1105 UTSW 2 87034084 missense possibly damaging 0.88
R4563:Olfr1105 UTSW 2 87033684 missense probably damaging 1.00
R4718:Olfr1105 UTSW 2 87033895 missense probably damaging 0.99
R6362:Olfr1105 UTSW 2 87033289 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTACAGTTAGGTGGGACGCACAAG -3'
(R):5'- TGACCGAGGACCCTGTACTGAATAC -3'

Sequencing Primer
(F):5'- GGATAAAGCCTTATAACTTCCCCTGG -3'
(R):5'- GGACCCTGTACTGAATACTGTACTC -3'
Posted On2014-06-06