Incidental Mutation 'R2312:Tlr2'
ID247326
Institutional Source Beutler Lab
Gene Symbol Tlr2
Ensembl Gene ENSMUSG00000027995
Gene Nametoll-like receptor 2
SynonymsLy105
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location83836272-83841767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83837540 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 412 (L412P)
Ref Sequence ENSEMBL: ENSMUSP00000029623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029623]
Predicted Effect probably damaging
Transcript: ENSMUST00000029623
AA Change: L412P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029623
Gene: ENSMUSG00000027995
AA Change: L412P

DomainStartEndE-ValueType
LRR 51 74 1.45e2 SMART
LRR 75 98 2.33e2 SMART
LRR_TYP 99 122 3.69e-4 SMART
low complexity region 268 281 N/A INTRINSIC
LRR 359 384 6.78e1 SMART
LRR 386 409 2.54e2 SMART
LRR 412 435 8.49e1 SMART
LRR_TYP 476 499 3.34e-2 SMART
LRRCT 533 586 5.04e-7 SMART
transmembrane domain 588 610 N/A INTRINSIC
TIR 640 784 5.08e-38 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice demonstrate abnormal responses to bacterial and viral infections. Mice homozygous for a knock-out allele also exhibit disruption in circadian active and inactive state consolidation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Tlr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01762:Tlr2 APN 3 83836994 missense probably benign
IGL02160:Tlr2 APN 3 83837371 missense possibly damaging 0.47
IGL02405:Tlr2 APN 3 83836674 missense probably damaging 1.00
IGL02940:Tlr2 APN 3 83836474 missense probably benign 0.03
IGL03165:Tlr2 APN 3 83837948 missense probably benign 0.00
languid UTSW 3 83837315 missense probably damaging 1.00
PIT4131001:Tlr2 UTSW 3 83838449 missense probably benign 0.34
R1177:Tlr2 UTSW 3 83838734 missense probably benign 0.02
R1251:Tlr2 UTSW 3 83838269 missense possibly damaging 0.64
R1346:Tlr2 UTSW 3 83836593 missense probably damaging 0.99
R1553:Tlr2 UTSW 3 83837463 missense probably benign
R1613:Tlr2 UTSW 3 83837353 missense probably damaging 1.00
R1816:Tlr2 UTSW 3 83838209 missense probably damaging 1.00
R3023:Tlr2 UTSW 3 83837871 missense probably benign
R4724:Tlr2 UTSW 3 83838185 missense probably damaging 1.00
R4950:Tlr2 UTSW 3 83837332 missense probably damaging 1.00
R5109:Tlr2 UTSW 3 83837723 missense probably damaging 1.00
R5764:Tlr2 UTSW 3 83838512 missense probably damaging 1.00
R5859:Tlr2 UTSW 3 83836503 missense possibly damaging 0.94
R6169:Tlr2 UTSW 3 83838148 missense probably benign
R6236:Tlr2 UTSW 3 83838131 missense probably benign
R6384:Tlr2 UTSW 3 83836994 missense probably benign
R6564:Tlr2 UTSW 3 83837695 missense probably benign 0.05
R6725:Tlr2 UTSW 3 83838296 missense probably benign
R7032:Tlr2 UTSW 3 83837905 missense probably benign 0.01
R7256:Tlr2 UTSW 3 83837606 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGCATCTGGGAGTGTTTTCAG -3'
(R):5'- CAGCAAGGTCTTCCTGGTTC -3'

Sequencing Primer
(F):5'- TCTGGAAATATAGAGCTCTTGCAG -3'
(R):5'- AAGGTCTTCCTGGTTCCCTGC -3'
Posted On2014-11-11