Incidental Mutation 'R2312:Dapk1'
ID247365
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Namedeath associated protein kinase 1
SynonymsDAP-Kinase, 2310039H24Rik, D13Ucla1, 2810425C21Rik
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2312 (G1)
Quality Score214
Status Not validated
Chromosome13
Chromosomal Location60601947-60763191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 60757353 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 959 (C959F)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
Predicted Effect probably damaging
Transcript: ENSMUST00000044083
AA Change: C959F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: C959F

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077453
AA Change: C959F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: C959F

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225952
Predicted Effect probably damaging
Transcript: ENSMUST00000226059
AA Change: C959F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60761040 missense probably benign 0.23
IGL00500:Dapk1 APN 13 60760804 missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60761248 missense probably benign 0.00
IGL00903:Dapk1 APN 13 60761397 missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60760798 missense probably benign
IGL01535:Dapk1 APN 13 60731031 splice site probably benign
IGL01755:Dapk1 APN 13 60761175 missense probably damaging 0.97
IGL01755:Dapk1 APN 13 60761176 missense possibly damaging 0.63
IGL01862:Dapk1 APN 13 60726610 missense probably benign 0.39
IGL01985:Dapk1 APN 13 60736260 missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60730882 missense probably benign
IGL02376:Dapk1 APN 13 60696394 missense probably benign 0.00
IGL02449:Dapk1 APN 13 60719770 splice site probably benign
IGL02490:Dapk1 APN 13 60749334 missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60761807 nonsense probably null
IGL02516:Dapk1 APN 13 60696347 missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60751217 missense probably benign
IGL02604:Dapk1 APN 13 60748320 missense probably benign
IGL03035:Dapk1 APN 13 60716773 missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60761312 missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60718149 splice site probably benign
R0116:Dapk1 UTSW 13 60761100 missense probably benign
R0165:Dapk1 UTSW 13 60761593 missense probably benign 0.39
R0357:Dapk1 UTSW 13 60729558 nonsense probably null
R0446:Dapk1 UTSW 13 60725287 splice site probably null
R0502:Dapk1 UTSW 13 60730848 synonymous probably null
R0503:Dapk1 UTSW 13 60730848 synonymous probably null
R0597:Dapk1 UTSW 13 60761384 missense probably benign 0.40
R0614:Dapk1 UTSW 13 60718132 missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60757448 missense probably benign 0.14
R1023:Dapk1 UTSW 13 60730985 missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60721865 critical splice donor site probably null
R1101:Dapk1 UTSW 13 60716785 missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60754143 missense probably benign 0.28
R1630:Dapk1 UTSW 13 60729531 missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60718464 critical splice donor site probably null
R1799:Dapk1 UTSW 13 60719654 missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60721857 missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60751208 missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60729531 missense possibly damaging 0.91
R2131:Dapk1 UTSW 13 60761667 missense possibly damaging 0.80
R2154:Dapk1 UTSW 13 60729503 missense probably benign 0.36
R2288:Dapk1 UTSW 13 60761749 missense probably damaging 1.00
R2362:Dapk1 UTSW 13 60730931 missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60752216 missense probably benign 0.34
R2909:Dapk1 UTSW 13 60716817 critical splice donor site probably null
R2926:Dapk1 UTSW 13 60719750 missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60748200 missense probably benign 0.09
R3810:Dapk1 UTSW 13 60760689 missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4375:Dapk1 UTSW 13 60761589 missense probably benign
R4377:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4490:Dapk1 UTSW 13 60718128 missense probably benign 0.26
R4576:Dapk1 UTSW 13 60721822 missense probably benign 0.13
R4599:Dapk1 UTSW 13 60718047 missense probably benign 0.22
R4682:Dapk1 UTSW 13 60751147 missense probably benign 0.41
R4717:Dapk1 UTSW 13 60726662 critical splice donor site probably null
R4775:Dapk1 UTSW 13 60749342 missense probably benign 0.02
R4790:Dapk1 UTSW 13 60723105 frame shift probably null
R4897:Dapk1 UTSW 13 60761786 missense probably benign 0.01
R4931:Dapk1 UTSW 13 60760960 missense probably benign 0.04
R5113:Dapk1 UTSW 13 60721778 missense probably benign 0.01
R5503:Dapk1 UTSW 13 60725312 missense probably benign 0.15
R5948:Dapk1 UTSW 13 60729395 missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60761662 missense probably benign 0.00
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60761766 missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60761326 missense probably benign 0.01
R6331:Dapk1 UTSW 13 60729442 nonsense probably null
R6553:Dapk1 UTSW 13 60761161 missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60761347 missense probably benign 0.03
R6602:Dapk1 UTSW 13 60749204 missense probably benign 0.20
R6640:Dapk1 UTSW 13 60716814 missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60760894 missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60725340 missense probably benign 0.22
R6799:Dapk1 UTSW 13 60752235 missense probably benign
R6809:Dapk1 UTSW 13 60751289 missense probably benign 0.00
R6915:Dapk1 UTSW 13 60696442 missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60736324 missense probably benign 0.11
R6979:Dapk1 UTSW 13 60748281 missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60696395 missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60761785 missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60754210 missense probably benign 0.02
R7203:Dapk1 UTSW 13 60696335 missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60719641 missense probably benign 0.00
R7448:Dapk1 UTSW 13 60751176 missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60757497 missense probably benign 0.18
R7532:Dapk1 UTSW 13 60730886 missense not run
Predicted Primers PCR Primer
(F):5'- CGTTAGCTGAGTTCCTAGTTCC -3'
(R):5'- TAGCTGTTGTGCAATGCGC -3'

Sequencing Primer
(F):5'- AGCTGCAAGGACTGTTCATC -3'
(R):5'- AATGCGCCTGAGGTCATC -3'
Posted On2014-11-11