Incidental Mutation 'R3437:Bad'
List |< first << previous [record 7 of 44] next >> last >|
ID267259
Institutional Source Beutler Lab
Gene Symbol Bad
Ensembl Gene ENSMUSG00000024959
Gene NameBCL2-associated agonist of cell death
SynonymsBbc2
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6941861-6951898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6942431 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 37 (R37G)
Ref Sequence ENSEMBL: ENSMUSP00000109053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025909] [ENSMUST00000025910] [ENSMUST00000099774] [ENSMUST00000099776] [ENSMUST00000099782] [ENSMUST00000113423] [ENSMUST00000113426] [ENSMUST00000166115]
Predicted Effect probably benign
Transcript: ENSMUST00000025909
SMART Domains Protein: ENSMUSP00000025909
Gene: ENSMUSG00000024958

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
transmembrane domain 273 295 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025910
AA Change: R37G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025910
Gene: ENSMUSG00000024959
AA Change: R37G

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 204 5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099774
SMART Domains Protein: ENSMUSP00000097362
Gene: ENSMUSG00000024958

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 91 113 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099776
SMART Domains Protein: ENSMUSP00000097364
Gene: ENSMUSG00000024958

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099782
SMART Domains Protein: ENSMUSP00000097370
Gene: ENSMUSG00000024958

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 65 76 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
transmembrane domain 122 144 N/A INTRINSIC
transmembrane domain 162 184 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 259 281 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113423
SMART Domains Protein: ENSMUSP00000109050
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 162 9.1e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113426
AA Change: R37G

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109053
Gene: ENSMUSG00000024959
AA Change: R37G

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 172 5.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141410
SMART Domains Protein: ENSMUSP00000114597
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 134 2.9e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166115
SMART Domains Protein: ENSMUSP00000130969
Gene: ENSMUSG00000024958

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
transmembrane domain 273 295 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
Meta Mutation Damage Score 0.1068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BCL-2 family. BCL-2 family members are known to be regulators of programmed cell death. This protein positively regulates cell apoptosis by forming heterodimers with BCL-xL and BCL-2, and reversing their death repressor activity. Proapoptotic activity of this protein is regulated through its phosphorylation. Protein kinases AKT and MAP kinase, as well as protein phosphatase calcineurin were found to be involved in the regulation of this protein. Alternative splicing of this gene results in two transcript variants which encode the same isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly normal and fertile. Both T and B cells show increased sensitivity to gamma irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 L127R probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Bad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02426:Bad APN 19 6951417 missense probably damaging 1.00
R4419:Bad UTSW 19 6950685 missense probably benign 0.14
R6662:Bad UTSW 19 6951070 intron probably benign
R6886:Bad UTSW 19 6951334 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTTACAGAGTTTTCACCAGCTCCC -3'
(R):5'- GAATAGGTCTCACCCCAAGC -3'

Sequencing Primer
(F):5'- CCCCATTTTACAGGAGGGAATTCG -3'
(R):5'- ATCTCGAGGCCCCTGAC -3'
Posted On2015-02-18