Incidental Mutation 'R4401:Pla2g1b'
ID326626
Institutional Source Beutler Lab
Gene Symbol Pla2g1b
Ensembl Gene ENSMUSG00000029522
Gene Namephospholipase A2, group IB, pancreas
SynonymsPla2a, sPLA2IB
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115466262-115474722 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 115470888 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 47 (Y47*)
Ref Sequence ENSEMBL: ENSMUSP00000138683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031495] [ENSMUST00000112071] [ENSMUST00000125568] [ENSMUST00000145785]
Predicted Effect probably null
Transcript: ENSMUST00000031495
AA Change: Y47*
SMART Domains Protein: ENSMUSP00000031495
Gene: ENSMUSG00000029522
AA Change: Y47*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PA2c 23 146 1.34e-66 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112071
AA Change: Y47*
SMART Domains Protein: ENSMUSP00000107702
Gene: ENSMUSG00000029522
AA Change: Y47*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PA2c 23 82 2.08e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125568
AA Change: Y46*
SMART Domains Protein: ENSMUSP00000120743
Gene: ENSMUSG00000029522
AA Change: Y46*

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
PA2c 22 124 2.58e-45 SMART
Predicted Effect probably null
Transcript: ENSMUST00000145785
AA Change: Y47*
SMART Domains Protein: ENSMUSP00000138683
Gene: ENSMUSG00000029522
AA Change: Y47*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PA2c 23 76 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202822
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted member of the phospholipase A2 (PLA2) class of enzymes, which is produced by the pancreatic acinar cells. The encoded calcium-dependent enzyme catalyzes the hydrolysis of the sn-2 position of membrane glycerophospholipids to release arachidonic acid (AA) and lysophospholipids. AA is subsequently converted by downstream metabolic enzymes to several bioactive lipophilic compounds (eicosanoids), including prostaglandins (PGs) and leukotrienes (LTs). The enzyme may be involved in several physiological processes including cell contraction, cell proliferation and pathological response. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in lipid absorption, increased insulin sensitivity and improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Pla2g1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03282:Pla2g1b APN 5 115470880 missense probably damaging 0.99
IGL03367:Pla2g1b APN 5 115472114 missense probably damaging 1.00
R4402:Pla2g1b UTSW 5 115470888 nonsense probably null
R4403:Pla2g1b UTSW 5 115470888 nonsense probably null
R4958:Pla2g1b UTSW 5 115470826 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGCACATTAGTAGGCTTCTGGG -3'
(R):5'- AATACACACGACGCTCAGGG -3'

Sequencing Primer
(F):5'- TCCCGAGGCAGCAACTGATAG -3'
(R):5'- AGGGACTGTGCATGCCTC -3'
Posted On2015-07-07