Incidental Mutation 'R4427:Tmx3'
ID328254
Institutional Source Beutler Lab
Gene Symbol Tmx3
Ensembl Gene ENSMUSG00000024614
Gene Namethioredoxin-related transmembrane protein 3
Synonyms6430411B10Rik, A730024F05Rik, Txndc10
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.463) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location90510154-90543267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90523601 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 158 (V158D)
Ref Sequence ENSEMBL: ENSMUSP00000025515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025515]
Predicted Effect probably damaging
Transcript: ENSMUST00000025515
AA Change: V158D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025515
Gene: ENSMUSG00000024614
AA Change: V158D

DomainStartEndE-ValueType
Pfam:Thioredoxin 30 132 3.6e-26 PFAM
Pfam:Thioredoxin_6 160 341 1.6e-27 PFAM
transmembrane domain 377 399 N/A INTRINSIC
low complexity region 418 436 N/A INTRINSIC
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and a C-terminal ER-retention sequence. This gene is expressed in many tissues but has its highest expression in heart and skeletal muscle. It is expressed in the retinal neuroepithelium and lens epithelium in the developing murine eye and haploinsufficiency of this gene in humans and zebrafish is associated with microphthalmia. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Tmx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Tmx3 APN 18 90540054 missense possibly damaging 0.53
IGL01790:Tmx3 APN 18 90511334 critical splice donor site probably null
IGL01888:Tmx3 APN 18 90527921 missense probably benign 0.05
IGL02689:Tmx3 APN 18 90537116 missense possibly damaging 0.70
IGL03212:Tmx3 APN 18 90538518 missense probably damaging 0.98
R0243:Tmx3 UTSW 18 90538489 splice site probably benign
R0255:Tmx3 UTSW 18 90540006 missense probably damaging 0.96
R0981:Tmx3 UTSW 18 90537200 missense probably benign
R1528:Tmx3 UTSW 18 90537086 missense possibly damaging 0.89
R1772:Tmx3 UTSW 18 90532997 missense probably benign
R2144:Tmx3 UTSW 18 90517490 missense probably damaging 1.00
R2155:Tmx3 UTSW 18 90510381 splice site probably null
R2202:Tmx3 UTSW 18 90527913 missense probably damaging 1.00
R2444:Tmx3 UTSW 18 90540183 missense probably damaging 1.00
R2960:Tmx3 UTSW 18 90532992 missense probably damaging 0.98
R3435:Tmx3 UTSW 18 90527904 missense probably damaging 1.00
R3946:Tmx3 UTSW 18 90524335 missense possibly damaging 0.78
R4708:Tmx3 UTSW 18 90521039 critical splice donor site probably null
R5748:Tmx3 UTSW 18 90537101 missense probably benign 0.05
R5938:Tmx3 UTSW 18 90527934 missense possibly damaging 0.79
R6266:Tmx3 UTSW 18 90537210 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCATAGGCTGAAATTTTACTTGGG -3'
(R):5'- AAACAGGCATAGTGCTTTGC -3'

Sequencing Primer
(F):5'- TAAGTGCAGATAAACATTGCTAAAGC -3'
(R):5'- GGCATAGTGCTTTGCTTTAAAAAGG -3'
Posted On2015-07-07