Incidental Mutation 'R4428:Cmpk1'
ID328266
Institutional Source Beutler Lab
Gene Symbol Cmpk1
Ensembl Gene ENSMUSG00000028719
Gene Namecytidine monophosphate (UMP-CMP) kinase 1
Synonyms0610011D08Rik, Cmpk
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location114959336-114987241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114963362 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 180 (E180G)
Ref Sequence ENSEMBL: ENSMUSP00000030491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030491] [ENSMUST00000133066]
Predicted Effect probably benign
Transcript: ENSMUST00000030491
AA Change: E180G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030491
Gene: ENSMUSG00000028719
AA Change: E180G

DomainStartEndE-ValueType
Pfam:Zeta_toxin 20 220 8.3e-8 PFAM
Pfam:AAA_18 37 183 9.9e-12 PFAM
Pfam:ADK 39 202 9.7e-47 PFAM
Pfam:Thymidylate_kin 40 219 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133066
SMART Domains Protein: ENSMUSP00000118198
Gene: ENSMUSG00000028719

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
Pfam:ADK 39 61 9.2e-8 PFAM
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the enzymes required for cellular nucleic acid biosynthesis. This enzyme catalyzes the transfer of a phosphate group from ATP to CMP, UMP, or dCMP, to form the corresponding diphosphate nucleotide. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Cmpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Cmpk1 APN 4 114964924 missense probably benign 0.04
R0212:Cmpk1 UTSW 4 114965019 missense possibly damaging 0.49
R0441:Cmpk1 UTSW 4 114965023 missense probably benign 0.00
R1316:Cmpk1 UTSW 4 114971290 intron probably benign
R5851:Cmpk1 UTSW 4 114986970 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GCTGTAGGTTAATTGTCCTCCC -3'
(R):5'- TCCGAGATGAAGCCATACCC -3'

Sequencing Primer
(F):5'- CTCTTCCACATTACAGAAAGGGTG -3'
(R):5'- AGACACATTGAGTTTAATGCAGG -3'
Posted On2015-07-07