Incidental Mutation 'R4428:Tmem68'
ID328265
Institutional Source Beutler Lab
Gene Symbol Tmem68
Ensembl Gene ENSMUSG00000028232
Gene Nametransmembrane protein 68
Synonyms
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location3549041-3574853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3569534 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 52 (I52K)
Ref Sequence ENSEMBL: ENSMUSP00000123591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029891] [ENSMUST00000134451] [ENSMUST00000154922]
Predicted Effect probably benign
Transcript: ENSMUST00000029891
AA Change: I52K

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029891
Gene: ENSMUSG00000028232
AA Change: I52K

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
PlsC 123 238 3.98e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150676
Predicted Effect probably benign
Transcript: ENSMUST00000154922
AA Change: I52K

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123591
Gene: ENSMUSG00000028232
AA Change: I52K

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
Blast:PlsC 75 112 4e-15 BLAST
Blast:PlsC 123 163 1e-21 BLAST
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Tmem68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Tmem68 APN 4 3560536 missense probably damaging 1.00
IGL02433:Tmem68 APN 4 3569624 missense possibly damaging 0.79
IGL02537:Tmem68 APN 4 3569649 missense possibly damaging 0.95
IGL02886:Tmem68 APN 4 3569361 splice site probably benign
R0600:Tmem68 UTSW 4 3569667 missense probably damaging 0.99
R1670:Tmem68 UTSW 4 3560627 missense probably damaging 0.99
R3001:Tmem68 UTSW 4 3569588 missense probably damaging 1.00
R3002:Tmem68 UTSW 4 3569588 missense probably damaging 1.00
R3086:Tmem68 UTSW 4 3569594 missense possibly damaging 0.95
R5221:Tmem68 UTSW 4 3560561 missense possibly damaging 0.83
R5640:Tmem68 UTSW 4 3569512 missense probably benign
R6919:Tmem68 UTSW 4 3569669 missense possibly damaging 0.68
R7122:Tmem68 UTSW 4 3564107 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ACAATGTCAGTGCAACATGCC -3'
(R):5'- GAGACAGGATTTGGGATTTTCATC -3'

Sequencing Primer
(F):5'- TGCAACATGCCAGGCCATG -3'
(R):5'- AGGATTTGGGATTTTCATCTAAGAAC -3'
Posted On2015-07-07