Incidental Mutation 'R4428:Umps'
ID328293
Institutional Source Beutler Lab
Gene Symbol Umps
Ensembl Gene ENSMUSG00000022814
Gene Nameuridine monophosphate synthetase
Synonyms1700095D23Rik
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33954782-33967038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 33961586 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 322 (V322G)
Ref Sequence ENSEMBL: ENSMUSP00000023510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023510] [ENSMUST00000131990]
Predicted Effect probably damaging
Transcript: ENSMUST00000023510
AA Change: V322G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023510
Gene: ENSMUSG00000022814
AA Change: V322G

DomainStartEndE-ValueType
Pfam:Pribosyltran 40 166 3.3e-14 PFAM
Blast:OMPdecase 190 237 1e-12 BLAST
OMPdecase 253 466 4.17e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131990
SMART Domains Protein: ENSMUSP00000119423
Gene: ENSMUSG00000022814

DomainStartEndE-ValueType
SCOP:d1lh0a_ 6 53 2e-5 SMART
PDB:2WNS|B 7 57 6e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145415
Meta Mutation Damage Score 0.394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine 5'-monophosphate synthase. The encoded protein is a bifunctional enzyme that catalyzes the final two steps of the de novo pyrimidine biosynthetic pathway. The first reaction is carried out by the N-terminal enzyme orotate phosphoribosyltransferase which converts orotic acid to orotidine-5'-monophosphate. The terminal reaction is carried out by the C-terminal enzyme OMP decarboxylase which converts orotidine-5'-monophosphate to uridine monophosphate. Defects in this gene are the cause of hereditary orotic aciduria. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Umps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Umps APN 16 33966902 missense probably damaging 1.00
IGL02833:Umps APN 16 33962153 nonsense probably null
R0584:Umps UTSW 16 33959124 missense probably damaging 1.00
R2888:Umps UTSW 16 33963870 missense probably damaging 1.00
R4125:Umps UTSW 16 33956918 nonsense probably null
R5261:Umps UTSW 16 33966974 missense probably benign 0.00
R6030:Umps UTSW 16 33962138 missense probably benign
R6030:Umps UTSW 16 33962138 missense probably benign
R7066:Umps UTSW 16 33961733 nonsense probably null
Z1088:Umps UTSW 16 33966825 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAGGCGTGGAATTCCCTAC -3'
(R):5'- CAATCTGTGTCTGTCTGCCGATG -3'

Sequencing Primer
(F):5'- TACCTGGGAAACAAATCAACAAAG -3'
(R):5'- ATGTGTCGGAGGCCAGG -3'
Posted On2015-07-07