Incidental Mutation 'R4428:Rfk'
ID328298
Institutional Source Beutler Lab
Gene Symbol Rfk
Ensembl Gene ENSMUSG00000024712
Gene Nameriboflavin kinase
Synonymsflavokinase, 0610038L10Rik, ATP:riboflavin 5'-phosphotransferase
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location17394043-17401349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17398595 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 84 (H84Q)
Ref Sequence ENSEMBL: ENSMUSP00000025617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025617
AA Change: H84Q

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025617
Gene: ENSMUSG00000024712
AA Change: H84Q

DomainStartEndE-ValueType
Flavokinase 1 131 5.68e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146171
Meta Mutation Damage Score 0.518 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Riboflavin kinase (RFK; EC 2.7.1.26) is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis (Karthikeyan et al., 2003 [PubMed 12623014]).[supplied by OMIM, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele die in utero prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Rfk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Rfk APN 19 17395336 missense probably benign
IGL03124:Rfk APN 19 17398595 missense possibly damaging 0.53
PIT4544001:Rfk UTSW 19 17395344 missense probably damaging 1.00
R1193:Rfk UTSW 19 17395321 missense probably damaging 0.99
R2360:Rfk UTSW 19 17398596 missense probably benign 0.01
R3692:Rfk UTSW 19 17399470 splice site probably null
R4151:Rfk UTSW 19 17395308 missense probably benign 0.03
R5072:Rfk UTSW 19 17398599 missense possibly damaging 0.79
R5121:Rfk UTSW 19 17399566 missense probably damaging 1.00
R5469:Rfk UTSW 19 17395202 missense probably damaging 1.00
R5715:Rfk UTSW 19 17398638 missense probably benign 0.00
R5851:Rfk UTSW 19 17395198 missense probably damaging 1.00
R6050:Rfk UTSW 19 17399532 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACCAGCTGGATGAATTTCAGGG -3'
(R):5'- TGGTACTAGGTCAGAGCAACAG -3'

Sequencing Primer
(F):5'- GTGTAGCCATCACTGTCCTGG -3'
(R):5'- CCTCACATGGCTACTGAAGGTAAG -3'
Posted On2015-07-07