Incidental Mutation 'R4741:Angptl2'
ID358060
Institutional Source Beutler Lab
Gene Symbol Angptl2
Ensembl Gene ENSMUSG00000004105
Gene Nameangiopoietin-like 2
SynonymsArp2
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location33216069-33247717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33246188 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 462 (Y462H)
Ref Sequence ENSEMBL: ENSMUSP00000004208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
Predicted Effect probably benign
Transcript: ENSMUST00000004208
AA Change: Y462H

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: Y462H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143252
Predicted Effect probably benign
Transcript: ENSMUST00000193373
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Angptl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Angptl2 APN 2 33228394 missense probably damaging 1.00
IGL00585:Angptl2 APN 2 33246227 missense probably damaging 0.98
IGL00900:Angptl2 APN 2 33243772 missense probably benign 0.00
IGL01521:Angptl2 APN 2 33246203 missense probably damaging 1.00
IGL02711:Angptl2 APN 2 33228243 missense probably benign 0.00
IGL02826:Angptl2 APN 2 33228315 missense probably benign 0.19
R1309:Angptl2 UTSW 2 33246128 missense probably benign 0.38
R1541:Angptl2 UTSW 2 33246165 missense probably benign 0.26
R1542:Angptl2 UTSW 2 33228885 missense probably benign 0.24
R1604:Angptl2 UTSW 2 33243773 missense possibly damaging 0.89
R3432:Angptl2 UTSW 2 33228802 missense probably benign 0.02
R4331:Angptl2 UTSW 2 33228748 missense probably damaging 0.99
R4652:Angptl2 UTSW 2 33243883 missense probably damaging 1.00
R5107:Angptl2 UTSW 2 33228603 missense probably damaging 0.98
R5504:Angptl2 UTSW 2 33229038 intron probably benign
R5694:Angptl2 UTSW 2 33228616 missense probably damaging 1.00
R5967:Angptl2 UTSW 2 33228706 missense probably damaging 1.00
R6185:Angptl2 UTSW 2 33229014 missense probably benign 0.00
R6797:Angptl2 UTSW 2 33228265 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACACGCACTATGGATGG -3'
(R):5'- TTCCATCGTCTGACAGAGCC -3'

Sequencing Primer
(F):5'- CACTATGGATGGGGCAAACC -3'
(R):5'- ATCGTCTGACAGAGCCACATTGG -3'
Posted On2015-11-11