Incidental Mutation 'R4741:Rnf225'
ID358078
Institutional Source Beutler Lab
Gene Symbol Rnf225
Ensembl Gene ENSMUSG00000033967
Gene Namering finger protein 225
Synonyms2310014L17Rik
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12927416-12931072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12927930 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 12 (H12L)
Ref Sequence ENSEMBL: ENSMUSP00000042816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004554] [ENSMUST00000045870] [ENSMUST00000108539] [ENSMUST00000137329] [ENSMUST00000147435]
Predicted Effect probably benign
Transcript: ENSMUST00000004554
SMART Domains Protein: ENSMUSP00000004554
Gene: ENSMUSG00000012848

DomainStartEndE-ValueType
Pfam:Ribosomal_S7 49 204 3.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045870
AA Change: H12L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000042816
Gene: ENSMUSG00000033967
AA Change: H12L

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
RING 63 110 2.91e-6 SMART
low complexity region 150 170 N/A INTRINSIC
low complexity region 175 196 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
low complexity region 266 278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083072
Predicted Effect probably benign
Transcript: ENSMUST00000108539
SMART Domains Protein: ENSMUSP00000104179
Gene: ENSMUSG00000012848

DomainStartEndE-ValueType
Pfam:Ribosomal_S7 51 204 1.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131795
Predicted Effect probably benign
Transcript: ENSMUST00000137329
SMART Domains Protein: ENSMUSP00000121961
Gene: ENSMUSG00000012848

DomainStartEndE-ValueType
Pfam:Ribosomal_S7 49 182 1.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139349
Predicted Effect probably benign
Transcript: ENSMUST00000147435
SMART Domains Protein: ENSMUSP00000118798
Gene: ENSMUSG00000012848

DomainStartEndE-ValueType
Pfam:Ribosomal_S7 49 182 1.2e-34 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Rnf225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Rnf225 APN 7 12928900 unclassified probably benign
R0033:Rnf225 UTSW 7 12928158 missense probably damaging 1.00
R4541:Rnf225 UTSW 7 12928593 unclassified probably null
R5388:Rnf225 UTSW 7 12928005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACAGTGGGTCCAAACAAG -3'
(R):5'- GAGACAGAATACGTGACCGC -3'

Sequencing Primer
(F):5'- AAGGACTCCCTGCCCTC -3'
(R):5'- CGTTTAGGCAGCTTGAAAATGCC -3'
Posted On2015-11-11