Incidental Mutation 'R5205:Aldh6a1'
ID398468
Institutional Source Beutler Lab
Gene Symbol Aldh6a1
Ensembl Gene ENSMUSG00000021238
Gene Namealdehyde dehydrogenase family 6, subfamily A1
SynonymsMmsdh, 1110038I05Rik
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84430717-84451004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84439644 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 167 (M167L)
Ref Sequence ENSEMBL: ENSMUSP00000082288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085192] [ENSMUST00000220491]
Predicted Effect probably damaging
Transcript: ENSMUST00000085192
AA Change: M167L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082288
Gene: ENSMUSG00000021238
AA Change: M167L

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:Aldedh 48 512 1.9e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220491
Predicted Effect probably benign
Transcript: ENSMUST00000221969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222656
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded enzyme is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This enzyme catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Mutations in the human gene result in Methylmalonate Semialdehyde Dehydrogenase Deficiency, characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Aldh6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Aldh6a1 APN 12 84439538 missense probably damaging 1.00
IGL02213:Aldh6a1 APN 12 84432552 intron probably benign
IGL02489:Aldh6a1 APN 12 84433972 missense possibly damaging 0.66
IGL02806:Aldh6a1 APN 12 84439640 missense probably damaging 1.00
IGL02930:Aldh6a1 APN 12 84433982 missense possibly damaging 0.78
IGL03183:Aldh6a1 APN 12 84436440 unclassified probably null
PIT4378001:Aldh6a1 UTSW 12 84441872 missense probably benign 0.01
R0015:Aldh6a1 UTSW 12 84441780 missense probably damaging 1.00
R0506:Aldh6a1 UTSW 12 84433526 missense probably damaging 1.00
R1458:Aldh6a1 UTSW 12 84439663 missense probably null 0.01
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1579:Aldh6a1 UTSW 12 84441848 missense possibly damaging 0.83
R2300:Aldh6a1 UTSW 12 84439529 missense probably damaging 1.00
R4351:Aldh6a1 UTSW 12 84443761 missense probably benign 0.00
R4447:Aldh6a1 UTSW 12 84439709 missense possibly damaging 0.73
R5242:Aldh6a1 UTSW 12 84436383 missense probably damaging 1.00
R5443:Aldh6a1 UTSW 12 84437971 splice site probably null
R6849:Aldh6a1 UTSW 12 84443787 missense probably benign 0.00
R7001:Aldh6a1 UTSW 12 84441888 missense probably damaging 1.00
R7182:Aldh6a1 UTSW 12 84441831 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TAATGTTCAGTGTTCCGTCAGG -3'
(R):5'- ATCGCTGTCAGTGGCATGAC -3'

Sequencing Primer
(F):5'- TCCTGAAGCAACTTAGCAAGG -3'
(R):5'- ATGACCCACCCCTGATTGTCAG -3'
Posted On2016-07-06