Incidental Mutation 'R5398:Olfr365'
ID429782
Institutional Source Beutler Lab
Gene Symbol Olfr365
Ensembl Gene ENSMUSG00000059429
Gene Nameolfactory receptor 365
SynonymsGA_x6K02T2NLDC-33885305-33886243, MOR138-1
MMRRC Submission 042969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R5398 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37188198-37206019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37201318 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 26 (Q26K)
Ref Sequence ENSEMBL: ENSMUSP00000151617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074168] [ENSMUST00000213969] [ENSMUST00000218602]
Predicted Effect probably benign
Transcript: ENSMUST00000074168
AA Change: Q26K

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073801
Gene: ENSMUSG00000059429
AA Change: Q26K

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
Pfam:7tm_4 33 309 4.7e-58 PFAM
Pfam:7tm_1 43 292 2.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213969
AA Change: Q26K

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000218602
AA Change: Q26K

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,872,579 L34P possibly damaging Het
Adam34 A C 8: 43,651,241 C456G probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Atp8b3 T C 10: 80,529,699 D407G probably damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Chac1 T G 2: 119,353,244 L109R possibly damaging Het
Csf2rb A G 15: 78,348,620 D709G probably benign Het
Ddx42 T A 11: 106,224,898 D112E probably benign Het
Dnah5 A G 15: 28,293,726 K1326E probably benign Het
Dnajc3 T A 14: 118,972,387 Y291* probably null Het
Dsg2 T C 18: 20,579,133 F109L probably benign Het
Egfl8 T C 17: 34,614,639 probably benign Het
Emb T A 13: 117,267,552 I280N probably damaging Het
Gcc2 C A 10: 58,269,507 N188K probably benign Het
Gdpd4 A T 7: 97,971,978 H166L probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Itga11 A G 9: 62,745,923 T360A probably benign Het
Kctd1 A G 18: 15,062,265 S434P possibly damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif24 T C 4: 41,394,401 E824G possibly damaging Het
Lekr1 T A 3: 65,781,386 noncoding transcript Het
Ociad1 T A 5: 73,310,412 V231E probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Pcdhb1 T C 18: 37,266,154 L386P probably damaging Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Pcnx2 T C 8: 125,887,948 K255E possibly damaging Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Ppl A G 16: 5,104,922 M235T probably benign Het
Prl7d1 T A 13: 27,710,074 I171F probably damaging Het
Ptprt T C 2: 161,927,592 Y451C probably damaging Het
Ranbp17 A T 11: 33,474,998 Y453N probably damaging Het
Rgs16 C T 1: 153,740,500 T11I probably benign Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Scn9a T C 2: 66,488,043 Y1479C probably damaging Het
Slc35f4 T C 14: 49,298,847 T294A probably damaging Het
Slc39a6 A T 18: 24,597,879 I345N probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spink12 A G 18: 44,107,727 D60G possibly damaging Het
Sppl2a T C 2: 126,919,718 I289V probably benign Het
Srebf2 A G 15: 82,171,242 T176A probably damaging Het
Syce1l T C 8: 113,652,513 L91S probably damaging Het
Tchhl1 T C 3: 93,471,603 I538T probably benign Het
Tcte1 C T 17: 45,539,826 Q343* probably null Het
Tdpoz2 T G 3: 93,652,134 D177A probably damaging Het
Thada T G 17: 84,426,186 D1011A probably benign Het
Tnn T A 1: 160,147,522 M112L probably benign Het
Traf1 T C 2: 34,945,435 E325G probably damaging Het
Tyw1 T C 5: 130,277,157 S374P probably benign Het
Vmn2r111 C A 17: 22,573,271 M1I probably null Het
Wdr11 C T 7: 129,631,232 T996M probably damaging Het
Other mutations in Olfr365
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Olfr365 APN 2 37201597 missense probably damaging 1.00
IGL00943:Olfr365 APN 2 37202171 missense probably benign 0.08
IGL01100:Olfr365 APN 2 37201640 missense possibly damaging 0.58
IGL01696:Olfr365 APN 2 37201511 missense probably benign 0.00
IGL02119:Olfr365 APN 2 37201269 missense possibly damaging 0.73
IGL02807:Olfr365 APN 2 37201574 missense probably damaging 1.00
IGL03030:Olfr365 APN 2 37201871 missense probably benign 0.00
R0388:Olfr365 UTSW 2 37202184 unclassified probably null
R0788:Olfr365 UTSW 2 37202023 missense possibly damaging 0.90
R1126:Olfr365 UTSW 2 37202101 missense probably benign
R1753:Olfr365 UTSW 2 37201427 missense probably damaging 1.00
R1822:Olfr365 UTSW 2 37201980 missense probably damaging 1.00
R1837:Olfr365 UTSW 2 37202102 missense probably benign 0.23
R3711:Olfr365 UTSW 2 37201273 missense probably benign
R4077:Olfr365 UTSW 2 37202012 missense possibly damaging 0.79
R4078:Olfr365 UTSW 2 37202012 missense possibly damaging 0.79
R4375:Olfr365 UTSW 2 37201562 missense probably benign 0.33
R4607:Olfr365 UTSW 2 37202082 nonsense probably null
R4608:Olfr365 UTSW 2 37202082 nonsense probably null
R4889:Olfr365 UTSW 2 37202045 missense probably damaging 1.00
R5560:Olfr365 UTSW 2 37201930 missense probably benign 0.01
R5670:Olfr365 UTSW 2 37201994 missense probably benign 0.19
R6108:Olfr365 UTSW 2 37201766 missense possibly damaging 0.68
R6727:Olfr365 UTSW 2 37202106 missense probably damaging 1.00
R6860:Olfr365 UTSW 2 37202177 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTTAAACAGACTTGGAGTTAGGGG -3'
(R):5'- ACTAGGCATCCCACATAGGAG -3'

Sequencing Primer
(F):5'- ACTTGGAGTTAGGGGAGAAGTTATTC -3'
(R):5'- GCATCCCACATAGGAGATAGTCTTTG -3'
Posted On2016-09-06