Incidental Mutation 'R0547:Pgbd1'
ID44923
Institutional Source Beutler Lab
Gene Symbol Pgbd1
Ensembl Gene ENSMUSG00000055313
Gene NamepiggyBac transposable element derived 1
Synonyms4921509E05Rik
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0547 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21421275-21441058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21423518 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 169 (Y169H)
Ref Sequence ENSEMBL: ENSMUSP00000117669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099719] [ENSMUST00000122872] [ENSMUST00000145494] [ENSMUST00000148071] [ENSMUST00000151743]
Predicted Effect probably damaging
Transcript: ENSMUST00000099719
AA Change: Y169H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097307
Gene: ENSMUSG00000055313
AA Change: Y169H

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122872
AA Change: Y132H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120175
Gene: ENSMUSG00000055313
AA Change: Y132H

DomainStartEndE-ValueType
Blast:SCAN 1 65 1e-13 BLAST
low complexity region 155 167 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 213 374 1.4e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145494
AA Change: Y169H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118503
Gene: ENSMUSG00000055313
AA Change: Y169H

DomainStartEndE-ValueType
Blast:SCAN 1 65 8e-15 BLAST
low complexity region 192 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148071
SMART Domains Protein: ENSMUSP00000114882
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 3e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000151743
AA Change: Y169H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117669
Gene: ENSMUSG00000055313
AA Change: Y169H

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.7e-42 PFAM
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. This gene product is specifically expressed in the brain, however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Pgbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Pgbd1 APN 13 21423253 nonsense probably null
IGL03136:Pgbd1 APN 13 21433439 missense possibly damaging 0.46
R0206:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0208:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0420:Pgbd1 UTSW 13 21423166 missense possibly damaging 0.50
R0589:Pgbd1 UTSW 13 21434430 missense possibly damaging 0.92
R0854:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R0891:Pgbd1 UTSW 13 21422800 missense probably damaging 0.97
R1589:Pgbd1 UTSW 13 21423292 missense probably damaging 0.97
R1700:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R1815:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R2139:Pgbd1 UTSW 13 21423020 missense probably damaging 1.00
R3776:Pgbd1 UTSW 13 21428373 missense probably benign 0.00
R3870:Pgbd1 UTSW 13 21434370 missense possibly damaging 0.95
R3871:Pgbd1 UTSW 13 21434370 missense possibly damaging 0.95
R4580:Pgbd1 UTSW 13 21428329 missense probably benign 0.07
R5644:Pgbd1 UTSW 13 21423152 missense probably damaging 0.99
R6480:Pgbd1 UTSW 13 21423476 missense probably benign 0.13
R6978:Pgbd1 UTSW 13 21423262 missense probably damaging 1.00
R7084:Pgbd1 UTSW 13 21423130 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TTGGTCCAGCTCTTCTCAGGGATG -3'
(R):5'- GCCTTTCCCAGCAAAACCAGAGTG -3'

Sequencing Primer
(F):5'- CTCAGGGATGCTGGATGC -3'
(R):5'- TTGTACTTACCCCGTGTAGAAG -3'
Posted On2013-06-11