Incidental Mutation 'R0547:Rxfp1'
ID44889
Institutional Source Beutler Lab
Gene Symbol Rxfp1
Ensembl Gene ENSMUSG00000034009
Gene Namerelaxin/insulin-like family peptide receptor 1
SynonymsLgr7, LOC381489
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R0547 (G1)
Quality Score115
Status Validated
Chromosome3
Chromosomal Location79641611-79737880 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 79705569 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]
Predicted Effect probably null
Transcript: ENSMUST00000078527
SMART Domains Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
LRRNT 101 130 9.51e-1 SMART
LRR 126 148 3.65e1 SMART
LRR 149 172 1.19e1 SMART
LRR_TYP 173 196 4.61e-5 SMART
LRR 197 220 1.86e0 SMART
LRR 221 244 1.86e2 SMART
LRR 246 269 2.03e1 SMART
LRR 270 293 1.76e2 SMART
LRR_TYP 294 317 4.24e-4 SMART
LRR 318 341 1.15e1 SMART
LRR 342 365 3.65e1 SMART
Pfam:7tm_1 422 681 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182491
SMART Domains Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Rxfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Rxfp1 APN 3 79652216 missense possibly damaging 0.81
IGL01962:Rxfp1 APN 3 79686868 missense probably damaging 1.00
IGL01975:Rxfp1 APN 3 79660078 missense possibly damaging 0.95
IGL01998:Rxfp1 APN 3 79660096 missense probably benign 0.01
IGL02049:Rxfp1 APN 3 79650492 missense probably damaging 0.99
IGL02153:Rxfp1 APN 3 79660120 missense probably benign 0.00
IGL02490:Rxfp1 APN 3 79652167 critical splice donor site probably null
IGL02526:Rxfp1 APN 3 79670846 critical splice donor site probably null
IGL02985:Rxfp1 APN 3 79652226 missense possibly damaging 0.65
IGL03252:Rxfp1 APN 3 79667683 missense probably benign 0.29
juggler UTSW 3 79650591 nonsense probably null
R0123:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0134:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0230:Rxfp1 UTSW 3 79644975 missense probably damaging 1.00
R0257:Rxfp1 UTSW 3 79682535 missense possibly damaging 0.61
R0265:Rxfp1 UTSW 3 79667654 missense probably benign 0.00
R0362:Rxfp1 UTSW 3 79737793 start codon destroyed probably null 0.99
R0394:Rxfp1 UTSW 3 79652377 missense possibly damaging 0.58
R0422:Rxfp1 UTSW 3 79650731 missense probably benign 0.00
R0627:Rxfp1 UTSW 3 79648211 missense probably benign 0.00
R0671:Rxfp1 UTSW 3 79663293 splice site probably null
R1309:Rxfp1 UTSW 3 79663292 splice site probably null
R1756:Rxfp1 UTSW 3 79670881 missense probably benign 0.11
R1803:Rxfp1 UTSW 3 79737769 missense probably benign
R2415:Rxfp1 UTSW 3 79663319 missense probably benign 0.14
R2862:Rxfp1 UTSW 3 79682471 missense possibly damaging 0.80
R4087:Rxfp1 UTSW 3 79644949 missense probably damaging 0.99
R4091:Rxfp1 UTSW 3 79644761 missense probably benign
R4250:Rxfp1 UTSW 3 79652272 missense probably benign 0.41
R4335:Rxfp1 UTSW 3 79686798 critical splice donor site probably null
R4447:Rxfp1 UTSW 3 79652127 intron probably benign
R4607:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4608:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4676:Rxfp1 UTSW 3 79705668 missense probably damaging 1.00
R4768:Rxfp1 UTSW 3 79686868 missense probably damaging 1.00
R4812:Rxfp1 UTSW 3 79650582 missense probably benign 0.00
R4909:Rxfp1 UTSW 3 79644802 missense probably benign
R5059:Rxfp1 UTSW 3 79663312 missense probably benign
R5131:Rxfp1 UTSW 3 79652164 splice site probably null
R5641:Rxfp1 UTSW 3 79686892 missense probably damaging 0.98
R5711:Rxfp1 UTSW 3 79678747 missense probably damaging 1.00
R5757:Rxfp1 UTSW 3 79661320 missense possibly damaging 0.89
R5856:Rxfp1 UTSW 3 79663313 missense possibly damaging 0.76
R6296:Rxfp1 UTSW 3 79667848 missense probably damaging 1.00
R6462:Rxfp1 UTSW 3 79648289 missense probably benign 0.07
R6730:Rxfp1 UTSW 3 79650591 nonsense probably null
R7059:Rxfp1 UTSW 3 79652269 missense probably damaging 1.00
Z1088:Rxfp1 UTSW 3 79705704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCCCTGGGAGCATAAAGATAC -3'
(R):5'- GGGCCTACTTTGGGTGCTACATTAC -3'

Sequencing Primer
(F):5'- Ggtttgagtttctcagtgagc -3'
(R):5'- GGTGCTACATTACCCTTTCCAAC -3'
Posted On2013-06-11