Incidental Mutation 'R5734:St3gal1'
ID451607
Institutional Source Beutler Lab
Gene Symbol St3gal1
Ensembl Gene ENSMUSG00000013846
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 1
SynonymsSiat4a, CMP-N-acetylneuraminate: [beta-galactosidase alpha-2,3] sialytransferase, ST3GalI, Siat4
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location67102875-67176830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67106673 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 333 (I333N)
Ref Sequence ENSEMBL: ENSMUSP00000155359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092640] [ENSMUST00000229028] [ENSMUST00000229213]
Predicted Effect probably damaging
Transcript: ENSMUST00000092640
AA Change: I333N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090307
Gene: ENSMUSG00000013846
AA Change: I333N

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 80 336 1.7e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229028
AA Change: I333N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000229213
AA Change: I333N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229742
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. Correct glycosylation of the encoded protein may be critical to its sialyltransferase activity. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4B. Two transcript variants encoding the same protein have been found for this gene. Other transcript variants may exist, but have not been fully characterized yet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Lin28a A T 4: 134,007,973 C67* probably null Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in St3gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:St3gal1 APN 15 67112617 missense probably benign 0.03
Strasbourg UTSW 15 67106673 missense probably damaging 0.99
R0452:St3gal1 UTSW 15 67109655 splice site probably benign
R0478:St3gal1 UTSW 15 67113730 missense probably damaging 1.00
R0735:St3gal1 UTSW 15 67113687 missense probably benign
R2357:St3gal1 UTSW 15 67113782 missense probably benign 0.01
R5061:St3gal1 UTSW 15 67108229 missense probably benign 0.40
R5199:St3gal1 UTSW 15 67113715 missense probably benign 0.00
R5828:St3gal1 UTSW 15 67113785 nonsense probably null
R6370:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6371:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6373:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6385:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6387:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6388:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6417:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6420:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6421:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6462:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6463:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6469:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6473:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6474:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6759:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6760:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6894:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6963:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7250:St3gal1 UTSW 15 67106729 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTATCCTGGGAGAGTTGGACAAC -3'
(R):5'- CTATATGGGTCTCACCTTGGC -3'

Sequencing Primer
(F):5'- GTTGGACAACTTTGCTAAGTAGATG -3'
(R):5'- TATATGGGTCTCACCTTGGCTTTGC -3'
Posted On2017-01-03