Incidental Mutation 'R0564:Olfr809'
ID46078
Institutional Source Beutler Lab
Gene Symbol Olfr809
Ensembl Gene ENSMUSG00000050251
Gene Nameolfactory receptor 809
SynonymsMOR108-4, GA_x6K02T2PULF-11454600-11455541
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R0564 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129774638-129778937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129776136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 74 (V74G)
Ref Sequence ENSEMBL: ENSMUSP00000145037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059891] [ENSMUST00000203236] [ENSMUST00000203598] [ENSMUST00000204622] [ENSMUST00000218237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059891
AA Change: V74G

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054949
Gene: ENSMUSG00000050251
AA Change: V74G

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 3.5e-49 PFAM
Pfam:7tm_1 54 303 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203236
SMART Domains Protein: ENSMUSP00000145315
Gene: ENSMUSG00000049894

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.8e-53 PFAM
Pfam:7tm_1 39 288 7.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203598
AA Change: V74G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145037
Gene: ENSMUSG00000050251
AA Change: V74G

DomainStartEndE-ValueType
Pfam:7tm_4 29 148 8.1e-20 PFAM
Pfam:7tm_1 39 149 1.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204622
AA Change: V89G
SMART Domains Protein: ENSMUSP00000145260
Gene: ENSMUSG00000052818
AA Change: V89G

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 3.5e-49 PFAM
Pfam:7tm_1 54 303 1.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218237
AA Change: V89G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Olfr809
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01884:Olfr809 APN 10 129776828 missense probably benign 0.34
IGL02000:Olfr809 APN 10 129776069 missense probably benign 0.03
IGL02146:Olfr809 APN 10 129776858 utr 3 prime probably benign
IGL03087:Olfr809 APN 10 129776261 missense probably damaging 0.98
IGL03260:Olfr809 APN 10 129776652 missense probably damaging 1.00
PIT4466001:Olfr809 UTSW 10 129776273 missense probably benign 0.04
R0613:Olfr809 UTSW 10 129776262 missense probably damaging 1.00
R1165:Olfr809 UTSW 10 129776433 missense probably damaging 0.99
R1556:Olfr809 UTSW 10 129776373 missense probably benign 0.05
R5392:Olfr809 UTSW 10 129776315 missense probably benign 0.01
R6665:Olfr809 UTSW 10 129776247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGATCCTGAGCTTCAGGTTGTG -3'
(R):5'- ACTCCAGCCTTGGCAGATGTTTTC -3'

Sequencing Primer
(F):5'- GGTTGTGATTTTCTTTTTTCTGTTTC -3'
(R):5'- GAATTATCAGCATCAGCGTGGTC -3'
Posted On2013-06-11