Incidental Mutation 'R6527:Olfr736'
ID522026
Institutional Source Beutler Lab
Gene Symbol Olfr736
Ensembl Gene ENSMUSG00000047716
Gene Nameolfactory receptor 736
SynonymsMOR106-5, GA_x6K02T2PMLR-6089963-6090901
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50381163-50394192 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 50393428 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 224 (L224*)
Ref Sequence ENSEMBL: ENSMUSP00000149654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058965] [ENSMUST00000213402] [ENSMUST00000213755] [ENSMUST00000215227] [ENSMUST00000215263]
Predicted Effect probably null
Transcript: ENSMUST00000058965
AA Change: L224*
SMART Domains Protein: ENSMUSP00000062700
Gene: ENSMUSG00000047716
AA Change: L224*

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 37 175 6.9e-7 PFAM
Pfam:7tm_1 43 294 4.7e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213402
AA Change: L224*
Predicted Effect probably null
Transcript: ENSMUST00000213755
AA Change: L224*
Predicted Effect probably null
Transcript: ENSMUST00000215227
AA Change: L224*
Predicted Effect probably null
Transcript: ENSMUST00000215263
AA Change: L224*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Olfr736
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Olfr736 APN 14 50392834 missense probably benign 0.33
IGL01952:Olfr736 APN 14 50393403 missense probably benign 0.02
IGL01996:Olfr736 APN 14 50393659 missense probably damaging 0.99
IGL02694:Olfr736 APN 14 50392800 missense probably benign 0.02
IGL02717:Olfr736 APN 14 50393647 missense probably damaging 1.00
IGL03185:Olfr736 APN 14 50393398 missense probably damaging 0.99
IGL03218:Olfr736 APN 14 50393658 missense probably damaging 0.98
IGL03048:Olfr736 UTSW 14 50392788 missense possibly damaging 0.47
R0066:Olfr736 UTSW 14 50393202 missense probably benign 0.08
R0066:Olfr736 UTSW 14 50393202 missense probably benign 0.08
R0089:Olfr736 UTSW 14 50392864 missense probably benign
R0254:Olfr736 UTSW 14 50393079 missense probably damaging 0.99
R0284:Olfr736 UTSW 14 50392995 missense probably damaging 1.00
R1800:Olfr736 UTSW 14 50393329 nonsense probably null
R3885:Olfr736 UTSW 14 50392869 missense probably benign 0.05
R4302:Olfr736 UTSW 14 50393446 missense probably benign 0.23
R4452:Olfr736 UTSW 14 50392912 missense probably benign
R4705:Olfr736 UTSW 14 50392800 missense probably benign 0.02
R5340:Olfr736 UTSW 14 50393220 missense probably damaging 0.98
R6007:Olfr736 UTSW 14 50393491 missense probably damaging 1.00
R6338:Olfr736 UTSW 14 50393400 missense possibly damaging 0.47
R6358:Olfr736 UTSW 14 50393388 missense possibly damaging 0.78
R6521:Olfr736 UTSW 14 50393548 missense possibly damaging 0.95
R6777:Olfr736 UTSW 14 50393658 missense probably damaging 0.98
R6903:Olfr736 UTSW 14 50393632 missense possibly damaging 0.48
X0026:Olfr736 UTSW 14 50393541 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGATACTCATTACTCAGCTGCC -3'
(R):5'- TCGGAGGCTATAGATCATGGGG -3'

Sequencing Primer
(F):5'- CCATTTTGTGGGCCAAATGTGATAG -3'
(R):5'- GGCTATAGATCATGGGGTTGAAG -3'
Posted On2018-06-06