Incidental Mutation 'R6527:Osbpl8'
ID521997
Institutional Source Beutler Lab
Gene Symbol Osbpl8
Ensembl Gene ENSMUSG00000020189
Gene Nameoxysterol binding protein-like 8
SynonymsD330025H14Rik, ORP-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location111164752-111297249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111293205 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 884 (I884T)
Ref Sequence ENSEMBL: ENSMUSP00000100911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095310] [ENSMUST00000105275]
Predicted Effect probably benign
Transcript: ENSMUST00000095310
AA Change: I842T

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092948
Gene: ENSMUSG00000020189
AA Change: I842T

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
coiled coil region 71 102 N/A INTRINSIC
PH 107 225 3.65e-16 SMART
Pfam:Oxysterol_BP 364 715 6.4e-91 PFAM
coiled coil region 789 811 N/A INTRINSIC
transmembrane domain 829 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105275
AA Change: I884T

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189
AA Change: I884T

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the oxysterol-binding protein (Osbp) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal Osbp-like sterol-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit elevated of HDL and gender-specific alterations in lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Sqor A G 2: 122,809,286 Y434C probably damaging Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Osbpl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Osbpl8 APN 10 111273044 missense probably benign 0.30
IGL00826:Osbpl8 APN 10 111272320 splice site probably benign
IGL00839:Osbpl8 APN 10 111291510 missense probably benign 0.01
IGL01148:Osbpl8 APN 10 111276563 splice site probably benign
IGL01338:Osbpl8 APN 10 111267747 missense probably damaging 0.99
IGL01927:Osbpl8 APN 10 111270616 missense probably benign 0.00
IGL02378:Osbpl8 APN 10 111282145 missense possibly damaging 0.94
IGL02863:Osbpl8 APN 10 111284425 splice site probably benign
IGL02933:Osbpl8 APN 10 111282130 missense probably damaging 1.00
IGL03075:Osbpl8 APN 10 111291556 missense probably benign 0.01
R0388:Osbpl8 UTSW 10 111272282 missense probably benign
R0725:Osbpl8 UTSW 10 111286240 missense possibly damaging 0.64
R1353:Osbpl8 UTSW 10 111276479 missense probably damaging 0.97
R1434:Osbpl8 UTSW 10 111291581 missense probably benign 0.01
R1803:Osbpl8 UTSW 10 111275049 missense probably damaging 1.00
R1939:Osbpl8 UTSW 10 111289811 missense probably benign 0.19
R2847:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2848:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2849:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2879:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2935:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R3693:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R4088:Osbpl8 UTSW 10 111289790 missense possibly damaging 0.52
R4374:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4376:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4377:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4621:Osbpl8 UTSW 10 111269418 missense probably benign 0.01
R4622:Osbpl8 UTSW 10 111291496 missense probably benign 0.00
R4851:Osbpl8 UTSW 10 111204800 start codon destroyed probably null 0.00
R5134:Osbpl8 UTSW 10 111288693 missense probably benign 0.28
R5179:Osbpl8 UTSW 10 111272164 missense probably benign 0.01
R5309:Osbpl8 UTSW 10 111270557 missense probably benign 0.00
R5590:Osbpl8 UTSW 10 111272168 missense probably damaging 0.98
R5783:Osbpl8 UTSW 10 111267783 nonsense probably null
R6293:Osbpl8 UTSW 10 111272238 missense possibly damaging 0.96
R6362:Osbpl8 UTSW 10 111273068 nonsense probably null
R6751:Osbpl8 UTSW 10 111275013 missense possibly damaging 0.67
R6851:Osbpl8 UTSW 10 111270618 nonsense probably null
R6955:Osbpl8 UTSW 10 111269444 critical splice donor site probably null
R7224:Osbpl8 UTSW 10 111275011 missense possibly damaging 0.94
R7235:Osbpl8 UTSW 10 111269427 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGCTGTAGTTGACTGAGC -3'
(R):5'- CCAAACACAGTAGCTCTTGTTTTGG -3'

Sequencing Primer
(F):5'- ACTAGATACCTTGTGACAGTCAG -3'
(R):5'- CACAGTAGCTCTTGTTTTGGGTTAAG -3'
Posted On2018-06-06