Incidental Mutation 'R6527:Sqor'
ID521940
Institutional Source Beutler Lab
Gene Symbol Sqor
Ensembl Gene ENSMUSG00000005803
Gene Namesulfide quinone oxidoreductase
Synonyms0610039J17Rik, Sqrdl, flavo-binding protein, 4930557M22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R6527 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location122765237-122809569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122809286 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 434 (Y434C)
Ref Sequence ENSEMBL: ENSMUSP00000106133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005953] [ENSMUST00000110506] [ENSMUST00000126403] [ENSMUST00000176343]
Predicted Effect probably damaging
Transcript: ENSMUST00000005953
AA Change: Y434C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005953
Gene: ENSMUSG00000005803
AA Change: Y434C

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 44 189 1.7e-11 PFAM
SCOP:d1fcda1 240 364 2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110506
AA Change: Y434C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106133
Gene: ENSMUSG00000005803
AA Change: Y434C

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 342 7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126403
SMART Domains Protein: ENSMUSP00000117575
Gene: ENSMUSG00000005803

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 192 8.3e-8 PFAM
Predicted Effect silent
Transcript: ENSMUST00000176343
SMART Domains Protein: ENSMUSP00000135786
Gene: ENSMUSG00000005803

DomainStartEndE-ValueType
SCOP:d1fl2a1 25 132 6e-8 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function in mitochondria to catalyze the conversion of sulfide to persulfides, thereby decreasing toxic concencrations of sulfide. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,527 T826A probably damaging Het
Abca16 T A 7: 120,477,772 I686N possibly damaging Het
Abcb6 T C 1: 75,177,488 probably null Het
Adgrl3 A C 5: 81,787,517 E1299A probably damaging Het
Als2cr12 T C 1: 58,692,413 M1V probably null Het
Amd2 A C 10: 35,710,806 Y252D probably damaging Het
Cfap74 A G 4: 155,422,265 probably null Het
Dhx29 G T 13: 112,932,542 K135N probably damaging Het
Dlg5 T A 14: 24,190,448 D245V possibly damaging Het
Dscaml1 C T 9: 45,712,184 Q83* probably null Het
Dsp T A 13: 38,195,873 L1599Q probably damaging Het
Duox2 A G 2: 122,294,614 V369A probably benign Het
Gbe1 T A 16: 70,433,672 probably null Het
Gm7298 A G 6: 121,769,710 K600R probably benign Het
Heatr4 C T 12: 83,979,763 G240E probably damaging Het
Jakmip2 A G 18: 43,556,524 V651A possibly damaging Het
Jam3 C T 9: 27,155,344 R8Q unknown Het
Letm2 A G 8: 25,592,506 probably benign Het
Lmod3 T C 6: 97,247,378 D494G probably benign Het
Mast2 T C 4: 116,314,939 D604G probably damaging Het
Mif4gd C T 11: 115,609,275 probably null Het
Msr1 T C 8: 39,624,233 E112G possibly damaging Het
Mtus2 A G 5: 148,277,598 probably null Het
Muc4 A G 16: 32,753,433 H1103R probably benign Het
Nudt14 T A 12: 112,934,887 I198F possibly damaging Het
Olfr1341 T A 4: 118,709,848 F147Y possibly damaging Het
Olfr353 T C 2: 36,890,582 T89A probably benign Het
Olfr736 T A 14: 50,393,428 L224* probably null Het
Osbpl8 T C 10: 111,293,205 I884T probably benign Het
Podxl2 T C 6: 88,842,930 N550S probably damaging Het
Ppp1r9a A G 6: 5,045,949 Y151C probably damaging Het
Prss42 T C 9: 110,800,856 V226A possibly damaging Het
Psmd12 A G 11: 107,488,968 I116V probably damaging Het
Psme4 A C 11: 30,832,175 I872L probably benign Het
Rab11fip1 A T 8: 27,174,392 V65E probably damaging Het
Ros1 T C 10: 52,143,377 N700S possibly damaging Het
Slc15a4 G A 5: 127,596,709 T547M probably damaging Het
Slfn3 T A 11: 83,213,106 C268S probably benign Het
Smc5 T C 19: 23,228,190 Q794R probably benign Het
Steap4 T A 5: 7,978,502 L360H probably damaging Het
Sycp1 A G 3: 102,898,887 V496A probably benign Het
Tmem161b T G 13: 84,272,264 M128R probably benign Het
Tmem59l T C 8: 70,486,125 E102G probably damaging Het
Tnks A T 8: 34,873,093 V457D probably benign Het
Tomt A G 7: 101,900,392 Y230H probably damaging Het
Trim37 A G 11: 87,190,084 N561D probably damaging Het
V1ra8 T A 6: 90,203,313 I166K probably damaging Het
Vmn1r56 A G 7: 5,196,576 V14A probably benign Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwa8 A T 14: 78,947,213 S384C possibly damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp984 T C 4: 147,755,924 N157D probably benign Het
Zzef1 G A 11: 72,874,990 D1448N probably benign Het
Other mutations in Sqor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Sqor APN 2 122787543 missense probably damaging 0.97
IGL01544:Sqor APN 2 122792346 splice site probably benign
IGL02499:Sqor APN 2 122808087 missense possibly damaging 0.93
IGL02583:Sqor APN 2 122799770 missense probably damaging 0.98
IGL02732:Sqor APN 2 122799762 missense possibly damaging 0.76
IGL03137:Sqor APN 2 122808071 missense probably benign
H8786:Sqor UTSW 2 122792368 missense probably benign 0.10
R0126:Sqor UTSW 2 122798027 unclassified probably benign
R0410:Sqor UTSW 2 122787522 missense probably benign
R0502:Sqor UTSW 2 122798050 missense probably benign 0.04
R0709:Sqor UTSW 2 122799855 missense probably benign 0.38
R1486:Sqor UTSW 2 122807645 splice site probably null
R2001:Sqor UTSW 2 122798098 missense probably damaging 0.98
R2020:Sqor UTSW 2 122804107 critical splice donor site probably null
R2039:Sqor UTSW 2 122792404 critical splice donor site probably null
R2404:Sqor UTSW 2 122808023 missense probably benign
R4213:Sqor UTSW 2 122787498 missense probably damaging 1.00
R4909:Sqor UTSW 2 122785181 missense possibly damaging 0.82
R5630:Sqor UTSW 2 122809357 missense possibly damaging 0.71
R5659:Sqor UTSW 2 122787603 missense probably benign 0.02
R5728:Sqor UTSW 2 122809400 makesense probably null
R5772:Sqor UTSW 2 122809341 missense probably benign 0.00
R6657:Sqor UTSW 2 122807594 missense possibly damaging 0.68
R6843:Sqor UTSW 2 122784980 missense probably benign 0.00
R6843:Sqor UTSW 2 122809295 missense probably damaging 0.99
R7193:Sqor UTSW 2 122804009 missense probably damaging 1.00
R7320:Sqor UTSW 2 122799810 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACACAGCAAATTCAGTGTC -3'
(R):5'- TCTGGGTTGTCCACATGATAGC -3'

Sequencing Primer
(F):5'- TCAGTGTCAAAGCTAGGACTCATCG -3'
(R):5'- GTCCACATGATAGCTATTCAGAGGC -3'
Posted On2018-06-06