Incidental Mutation 'R6726:Serpinb6d'
ID529876
Institutional Source Beutler Lab
Gene Symbol Serpinb6d
Ensembl Gene ENSMUSG00000047889
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6d
SynonymsSPI3D, Gm11390
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6726 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33661405-33671581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33670735 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 231 (N231S)
Ref Sequence ENSEMBL: ENSMUSP00000152621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059637] [ENSMUST00000221681]
Predicted Effect probably benign
Transcript: ENSMUST00000059637
AA Change: N231S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000063025
Gene: ENSMUSG00000047889
AA Change: N231S

DomainStartEndE-ValueType
SERPIN 13 375 1.67e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221681
AA Change: N231S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene is a member of the large Serpin gene family. Many members of this family act as protease inhibitors, and have a conserved structure including a reactive center loop (RCL) that can act as a bait for protease targets. Unlike some members of this large gene family, the protein encoded by this gene is an intracellular protein, and lacks an N-terminal signal peptide sequence. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 13. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G C 17: 25,947,715 P283A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arfgef2 T A 2: 166,893,620 probably null Het
Arsk T C 13: 76,074,788 Y230C probably damaging Het
Atf7ip G A 6: 136,582,391 V737M probably damaging Het
Atp6v1e1 A T 6: 120,804,050 probably null Het
Bbs9 T C 9: 22,645,964 V3A probably benign Het
Brap T C 5: 121,675,302 S243P probably damaging Het
Camkmt T A 17: 85,394,609 I167N probably damaging Het
Ckap2l C A 2: 129,269,194 E694D probably damaging Het
Crmp1 G A 5: 37,284,064 V497I probably benign Het
Dbx2 A G 15: 95,624,860 V322A possibly damaging Het
Dll1 C A 17: 15,370,251 C401F probably damaging Het
Dock10 T C 1: 80,512,430 T1991A probably damaging Het
Dock3 C T 9: 107,159,452 W42* probably null Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Gm10093 A G 17: 78,492,858 E426G probably damaging Het
Gm5737 T C 7: 120,826,109 S308P probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Irs2 T C 8: 11,004,961 N1157S possibly damaging Het
Kndc1 T C 7: 139,922,751 probably null Het
Map3k19 T C 1: 127,820,448 N1241S probably benign Het
Olfr1015 T C 2: 85,785,562 F17S possibly damaging Het
Paqr5 C T 9: 61,963,783 R171Q probably damaging Het
Pcdh17 T A 14: 84,446,217 D41E probably damaging Het
Plg T G 17: 12,378,708 L14R probably damaging Het
Prkab1 A G 5: 116,020,033 V168A probably benign Het
Ptdss1 C T 13: 66,953,531 R95* probably null Het
Rab3gap2 T G 1: 185,247,865 S327A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Homo
Senp8 C A 9: 59,737,190 V228L probably benign Het
Serpina10 A T 12: 103,628,369 I197K probably benign Het
Sez6l2 T C 7: 126,968,005 V869A probably damaging Het
Sgo2b T A 8: 63,927,735 K688* probably null Het
Sh3kbp1 A T X: 159,841,180 E39D probably benign Homo
Ufsp2 T C 8: 45,985,467 M194T probably benign Het
Ush2a T C 1: 188,753,684 I2997T possibly damaging Het
Vmn2r107 G A 17: 20,375,375 G730D probably damaging Het
Wdr72 T C 9: 74,152,540 Y411H possibly damaging Het
Xirp2 T C 2: 67,512,868 S1818P possibly damaging Het
Other mutations in Serpinb6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Serpinb6d APN 13 33671363 missense probably benign 0.05
IGL01611:Serpinb6d APN 13 33666392 nonsense probably null
IGL01946:Serpinb6d APN 13 33671386 missense probably benign 0.22
IGL02672:Serpinb6d APN 13 33671389 missense probably benign 0.36
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R1112:Serpinb6d UTSW 13 33669135 missense probably damaging 1.00
R1159:Serpinb6d UTSW 13 33671229 missense probably damaging 0.98
R1447:Serpinb6d UTSW 13 33670756 missense probably benign 0.42
R1608:Serpinb6d UTSW 13 33669129 missense probably benign
R1843:Serpinb6d UTSW 13 33671381 missense probably benign
R1945:Serpinb6d UTSW 13 33667680 missense possibly damaging 0.95
R2168:Serpinb6d UTSW 13 33666374 missense probably benign 0.08
R2275:Serpinb6d UTSW 13 33671428 missense probably benign 0.00
R3737:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3738:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3739:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3780:Serpinb6d UTSW 13 33664114 missense probably benign
R3782:Serpinb6d UTSW 13 33664114 missense probably benign
R4002:Serpinb6d UTSW 13 33670647 missense probably damaging 0.98
R4685:Serpinb6d UTSW 13 33671228 missense probably damaging 1.00
R4707:Serpinb6d UTSW 13 33671353 missense possibly damaging 0.83
R4761:Serpinb6d UTSW 13 33671267 missense probably damaging 1.00
R4859:Serpinb6d UTSW 13 33667564 intron probably null
R4884:Serpinb6d UTSW 13 33666445 missense possibly damaging 0.76
R4951:Serpinb6d UTSW 13 33666383 missense probably benign 0.03
R5010:Serpinb6d UTSW 13 33671444 missense probably benign 0.15
R5081:Serpinb6d UTSW 13 33671247 missense probably benign 0.32
R6960:Serpinb6d UTSW 13 33671198 missense probably benign 0.08
R7214:Serpinb6d UTSW 13 33664145 missense probably damaging 1.00
Z1088:Serpinb6d UTSW 13 33671254 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCCAGAGATCATGACATTATTCTTC -3'
(R):5'- AATCTCTACAGTGCCCAGGG -3'

Sequencing Primer
(F):5'- AGATCATGACATTATTCTTCTGTTGG -3'
(R):5'- CCCAGGGAAGTGTGACTTTAAC -3'
Posted On2018-08-01