Incidental Mutation 'R6918:Olfr893'
ID539448
Institutional Source Beutler Lab
Gene Symbol Olfr893
Ensembl Gene ENSMUSG00000093901
Gene Nameolfactory receptor 893
SynonymsGA_x6K02T2PVTD-31889215-31890153, MOR170-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38208365-38211598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38209652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 198 (V198M)
Ref Sequence ENSEMBL: ENSMUSP00000148719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093867] [ENSMUST00000211975]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093867
AA Change: V200M

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091390
Gene: ENSMUSG00000093901
AA Change: V200M

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 1.2e-45 PFAM
Pfam:7tm_1 43 292 8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211975
AA Change: V198M

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000212815
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Olfr893
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Olfr893 APN 9 38209238 missense probably damaging 1.00
IGL00914:Olfr893 APN 9 38209799 intron probably null
IGL01563:Olfr893 APN 9 38209701 missense probably damaging 1.00
IGL01696:Olfr893 APN 9 38209049 unclassified probably benign
IGL02064:Olfr893 APN 9 38209578 missense probably damaging 1.00
IGL02605:Olfr893 APN 9 38209236 missense probably damaging 0.99
R0415:Olfr893 UTSW 9 38209973 missense probably benign
R0463:Olfr893 UTSW 9 38209064 missense probably benign 0.00
R0843:Olfr893 UTSW 9 38209283 missense possibly damaging 0.81
R1441:Olfr893 UTSW 9 38209481 missense probably damaging 1.00
R1939:Olfr893 UTSW 9 38209429 nonsense probably null
R2512:Olfr893 UTSW 9 38209374 missense probably damaging 1.00
R4890:Olfr893 UTSW 9 38209290 missense probably benign 0.00
R5439:Olfr893 UTSW 9 38209754 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTCTCCTCGGATGTGTTC -3'
(R):5'- TGATCTACAGATTCAGCGGATGC -3'

Sequencing Primer
(F):5'- CCCTGCTAATGATTGGGTCC -3'
(R):5'- GCTGGTTTGACATAAGTAAGCAGTCC -3'
Posted On2018-11-06