Incidental Mutation 'R7043:Olfr597'
ID547156
Institutional Source Beutler Lab
Gene Symbol Olfr597
Ensembl Gene ENSMUSG00000073952
Gene Nameolfactory receptor 597
SynonymsGA_x6K02T2PBJ9-6029614-6030561, MOR23-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103316315-103322799 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 103321085 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098203] [ENSMUST00000214765] [ENSMUST00000216456]
Predicted Effect
SMART Domains Protein: ENSMUSP00000095804
Gene: ENSMUSG00000073952
AA Change: Q225K

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 2.2e-89 PFAM
Pfam:7TM_GPCR_Srsx 41 312 5.7e-7 PFAM
Pfam:7tm_1 47 297 3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214765
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eif5 A G 12: 111,544,596 D423G probably benign Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Olfr597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Olfr597 APN 7 103321334 missense probably benign 0.27
IGL01872:Olfr597 APN 7 103320972 missense probably benign 0.17
IGL02797:Olfr597 APN 7 103320851 missense probably benign
IGL02811:Olfr597 APN 7 103320933 missense probably benign
PIT4131001:Olfr597 UTSW 7 103320869 nonsense probably null
R1800:Olfr597 UTSW 7 103320414 start codon destroyed probably null 0.98
R4921:Olfr597 UTSW 7 103320543 missense probably damaging 1.00
R6288:Olfr597 UTSW 7 103321079 missense probably damaging 0.97
R6993:Olfr597 UTSW 7 103320791 unclassified probably benign
R7322:Olfr597 UTSW 7 103321287 missense
Predicted Primers PCR Primer
(F):5'- CGAGCGGTAGTACTTGTAGG -3'
(R):5'- CCCGCTTTCGAATGACCATG -3'

Sequencing Primer
(F):5'- CGGTAGTACTTGTAGGCCTGTTACC -3'
(R):5'- CTCCATACACAATAGGGTTGAGAGC -3'
Posted On2019-05-13