Incidental Mutation 'R7043:Eif5'
ID547176
Institutional Source Beutler Lab
Gene Symbol Eif5
Ensembl Gene ENSMUSG00000021282
Gene Nameeukaryotic translation initiation factor 5
Synonyms2810011H21Rik, D12Ertd549e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.978) question?
Stock #R7043 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location111538016-111546752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111544596 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 423 (D423G)
Ref Sequence ENSEMBL: ENSMUSP00000152791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050993] [ENSMUST00000166123] [ENSMUST00000220803] [ENSMUST00000221292] [ENSMUST00000222234] [ENSMUST00000222375] [ENSMUST00000222388] [ENSMUST00000222441] [ENSMUST00000222757]
Predicted Effect probably benign
Transcript: ENSMUST00000050993
AA Change: D423G

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000061616
Gene: ENSMUSG00000021282
AA Change: D423G

DomainStartEndE-ValueType
eIF2B_5 13 128 7.62e-67 SMART
low complexity region 154 171 N/A INTRINSIC
low complexity region 172 190 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
eIF5C 296 386 7.85e-40 SMART
low complexity region 421 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166123
AA Change: D423G

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126825
Gene: ENSMUSG00000021282
AA Change: D423G

DomainStartEndE-ValueType
eIF2B_5 13 128 7.62e-67 SMART
low complexity region 154 171 N/A INTRINSIC
low complexity region 172 190 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
eIF5C 296 386 7.85e-40 SMART
low complexity region 421 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220803
Predicted Effect probably benign
Transcript: ENSMUST00000221101
Predicted Effect probably benign
Transcript: ENSMUST00000221292
Predicted Effect probably benign
Transcript: ENSMUST00000222234
Predicted Effect probably benign
Transcript: ENSMUST00000222375
AA Change: D423G

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000222388
AA Change: D369G

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000222441
Predicted Effect probably benign
Transcript: ENSMUST00000222757
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic translation initiation factor-5 (EIF5) interacts with the 40S initiation complex to promote hydrolysis of bound GTP with concomitant joining of the 60S ribosomal subunit to the 40S initiation complex. The resulting functional 80S ribosomal initiation complex is then active in peptidyl transfer and chain elongations (summary by Si et al., 1996 [PubMed 8663286]).[supplied by OMIM, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,332 D832G possibly damaging Het
Abca17 A G 17: 24,265,500 L1596P probably damaging Het
Actr3b A G 5: 25,849,938 M329V probably benign Het
Avpr1a C T 10: 122,449,681 R293C probably damaging Het
Bdp1 A T 13: 100,078,707 C390S probably benign Het
C2cd2l A T 9: 44,316,551 M131K probably damaging Het
Ccna2 T C 3: 36,570,153 probably benign Het
Cd53 T C 3: 106,763,261 D152G probably damaging Het
Cdpf1 A T 15: 85,808,284 V66E probably null Het
Chd9 G T 8: 91,034,215 probably benign Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Dst A G 1: 34,257,911 T5794A probably damaging Het
Eif2s1 G T 12: 78,877,108 R113L probably damaging Het
Eri1 A C 8: 35,478,638 D164E probably damaging Het
F7 A T 8: 13,033,997 R227S probably benign Het
Gm14496 T G 2: 182,000,327 I597S possibly damaging Het
Gpr85 T A 6: 13,835,877 N343Y probably damaging Het
H2-T23 A T 17: 36,031,911 S112T probably damaging Het
Itga9 C T 9: 118,769,116 P573S probably damaging Het
Kcnb2 A T 1: 15,312,926 M159L probably benign Het
Kmt5b T A 19: 3,815,220 S738R possibly damaging Het
Lrp1b T C 2: 40,922,414 N2393S possibly damaging Het
Mme T A 3: 63,345,217 Y427* probably null Het
Naip1 A G 13: 100,426,914 V581A probably damaging Het
Ndel1 A G 11: 68,822,624 L329P possibly damaging Het
Nthl1 T G 17: 24,638,670 V281G probably benign Het
Olfr597 C A 7: 103,321,085 probably benign Het
Per2 G T 1: 91,419,408 H1197Q probably benign Het
Plec G A 15: 76,209,128 probably benign Het
Prpf6 A T 2: 181,649,504 H704L probably benign Het
Recql5 C T 11: 115,930,676 probably null Het
Rimbp3 G A 16: 17,211,108 V799M probably damaging Het
Sema3f C T 9: 107,691,400 A169T possibly damaging Het
Serpinb9f T C 13: 33,325,987 I54T possibly damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc35g3 T C 11: 69,761,650 D12G probably benign Het
Sptbn1 A G 11: 30,103,323 V2252A probably benign Het
Stab2 T C 10: 86,870,246 N1750S probably damaging Het
Supt5 C A 7: 28,320,010 R543L probably benign Het
Syne1 T C 10: 5,072,193 E7806G possibly damaging Het
Syt12 T A 19: 4,451,021 M334L probably benign Het
Tk1 A G 11: 117,815,953 *234R probably null Het
Trp73 T G 4: 154,067,007 probably null Het
Ttn A G 2: 76,897,133 probably benign Het
Vmn2r11 T C 5: 109,052,232 I452V probably benign Het
Wwox G T 8: 114,679,838 V190L probably damaging Het
Wwp2 A G 8: 107,457,900 H80R probably benign Het
Zc3h3 A G 15: 75,809,636 I532T probably damaging Het
Zfp280d A G 9: 72,319,257 K328E probably damaging Het
Zfp365 A G 10: 67,909,826 S41P probably damaging Het
Other mutations in Eif5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Eif5 APN 12 111540555 missense probably damaging 1.00
IGL03399:Eif5 APN 12 111544590 missense probably damaging 0.99
Builder UTSW 12 111543608 missense probably damaging 1.00
Karenina UTSW 12 111542793 missense probably benign 0.16
Tolstoy UTSW 12 111543555 missense probably damaging 1.00
R0561:Eif5 UTSW 12 111540516 missense probably benign 0.20
R1633:Eif5 UTSW 12 111540287 missense probably damaging 0.99
R1717:Eif5 UTSW 12 111542217 missense probably benign 0.00
R2939:Eif5 UTSW 12 111540279 missense probably damaging 1.00
R3820:Eif5 UTSW 12 111540184 nonsense probably null
R4402:Eif5 UTSW 12 111541749 missense probably benign 0.01
R4532:Eif5 UTSW 12 111539884 nonsense probably null
R5040:Eif5 UTSW 12 111539850 missense probably damaging 0.99
R5379:Eif5 UTSW 12 111543555 missense probably damaging 1.00
R5575:Eif5 UTSW 12 111542306 missense probably damaging 0.98
R6278:Eif5 UTSW 12 111542793 missense probably benign 0.16
R6629:Eif5 UTSW 12 111543608 missense probably damaging 1.00
X0013:Eif5 UTSW 12 111544594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCAAGCATGAGCCCTTG -3'
(R):5'- CCCTAGATGTCTCATTGGGC -3'

Sequencing Primer
(F):5'- TTTAATCCTAGCACTCAGGCAG -3'
(R):5'- GGGCTTAATTATAGACCACTCACAG -3'
Posted On2019-05-13