Mutagenetix > Incidental Mutation

Incidental Mutation 'R1671:Sorl1'

187618

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

Sorla, mSorLA, LR11, 2900010L19Rik

MMRRC Submission

039707-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.319) question?

Stock #

R1671 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41876016-42035593 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41885296 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 2102 (C2102R)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably damaging
Transcript: ENSMUST00000060989
AA Change: C2102R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: C2102R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148800

Meta Mutation Damage Score

0.8899

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	A	C	14: 64,210,637 (GRCm39)	L197R	probably benign	Het
Arglu1	A	G	8: 8,733,896 (GRCm39)	V140A	possibly damaging	Het
Arhgef28	T	C	13: 98,067,542 (GRCm39)	E1461G	possibly damaging	Het
Best3	A	T	10: 116,860,573 (GRCm39)	D611V	possibly damaging	Het
Cenpf	T	C	1: 189,411,341 (GRCm39)		probably null	Het
Cenpj	A	C	14: 56,802,502 (GRCm39)	M21R	probably damaging	Het
Cltc	A	T	11: 86,623,421 (GRCm39)	H201Q	possibly damaging	Het
Col28a1	A	T	6: 8,083,773 (GRCm39)	N561K	possibly damaging	Het
Cyp2c70	G	A	19: 40,142,081 (GRCm39)	P470L	probably damaging	Het
Cyp4f14	G	A	17: 33,135,883 (GRCm39)		probably benign	Het
Ddi1	A	T	9: 6,266,225 (GRCm39)	V48D	possibly damaging	Het
Dnah11	A	C	12: 117,880,523 (GRCm39)	Y3866D	probably damaging	Het
Dnah9	A	G	11: 65,818,789 (GRCm39)	V3183A	probably damaging	Het
Elmo1	T	A	13: 20,472,054 (GRCm39)		probably benign	Het
Fap	T	A	2: 62,384,179 (GRCm39)	Y9F	possibly damaging	Het
Fbxo15	T	A	18: 84,977,231 (GRCm39)	S93T	possibly damaging	Het
Gal3st2	C	T	1: 93,801,400 (GRCm39)	R19C	probably damaging	Het
Gmnn	A	T	13: 24,936,054 (GRCm39)	*207R	probably null	Het
Gucy1a1	A	C	3: 82,013,529 (GRCm39)	I371S	probably damaging	Het
H1f11-ps	C	A	19: 47,159,294 (GRCm39)	V94L	possibly damaging	Het
Igsf10	G	T	3: 59,235,921 (GRCm39)	S1420*	probably null	Het
Itih5	G	T	2: 10,191,782 (GRCm39)	V106L	probably benign	Het
Itsn1	T	A	16: 91,609,038 (GRCm39)	I201K	probably damaging	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Lars2	C	T	9: 123,247,344 (GRCm39)	T283I	probably benign	Het
Loxhd1	T	C	18: 77,492,498 (GRCm39)	I1313T	probably damaging	Het
Mamdc4	T	A	2: 25,458,235 (GRCm39)	R368*	probably null	Het
Mdga1	A	T	17: 30,069,603 (GRCm39)	Y422N	probably damaging	Het
Mro	A	T	18: 74,003,126 (GRCm39)		probably benign	Het
Mroh2b	T	C	15: 4,980,776 (GRCm39)		probably null	Het
Nlrp1b	C	A	11: 71,092,085 (GRCm39)	V14L	probably benign	Het
Nos3	A	G	5: 24,588,838 (GRCm39)	D1157G	probably damaging	Het
Nrxn2	C	A	19: 6,523,780 (GRCm39)	R598S	probably damaging	Het
Or2av9	A	T	11: 58,381,435 (GRCm39)	W49R	possibly damaging	Het
Or4k1	T	C	14: 50,377,290 (GRCm39)	K269E	probably damaging	Het
Or52ae9	C	A	7: 103,389,617 (GRCm39)	A277S	possibly damaging	Het
Or8b101	A	G	9: 38,020,428 (GRCm39)	M144V	probably benign	Het
Otog	A	T	7: 45,911,210 (GRCm39)	D687V	probably damaging	Het
Pcsk5	C	T	19: 17,432,232 (GRCm39)	C1461Y	probably damaging	Het
Raet1d	A	G	10: 22,238,614 (GRCm39)	M1V	probably null	Het
Rnf6	A	T	5: 146,147,998 (GRCm39)	L340*	probably null	Het
Rsl1d1	T	C	16: 11,019,245 (GRCm39)	T99A	probably damaging	Het
Sbno1	A	T	5: 124,530,130 (GRCm39)		probably null	Het
Sipa1l1	A	G	12: 82,444,235 (GRCm39)	Y982C	probably damaging	Het
Sorbs3	G	T	14: 70,428,915 (GRCm39)	R417S	possibly damaging	Het
Sp140l2	C	T	1: 85,235,106 (GRCm39)		probably null	Het
Sptbn1	T	A	11: 30,092,245 (GRCm39)	I494F	possibly damaging	Het
Tank	T	A	2: 61,480,097 (GRCm39)	V211E	probably damaging	Het
Tbcd	T	A	11: 121,488,120 (GRCm39)	D840E	probably benign	Het
Tg	T	A	15: 66,564,236 (GRCm39)	C1146S	possibly damaging	Het
Tiam2	A	T	17: 3,557,109 (GRCm39)	E110V	probably damaging	Het
Tle4	A	T	19: 14,431,103 (GRCm39)	W560R	probably damaging	Het
Triml2	G	A	8: 43,636,780 (GRCm39)	R76H	possibly damaging	Het
Ttn	T	C	2: 76,541,964 (GRCm39)	E25347G	probably damaging	Het
Ube2e2	A	G	14: 18,586,889 (GRCm38)	L124P	probably damaging	Het
Vmn2r81	A	G	10: 79,103,265 (GRCm39)	K153E	probably benign	Het
Wnt16	A	T	6: 22,298,178 (GRCm39)	Y348F	probably damaging	Het
Xpo6	A	G	7: 125,707,715 (GRCm39)	V897A	possibly damaging	Het
Zbtb26	T	C	2: 37,326,377 (GRCm39)	T220A	probably benign	Het
Zik1	A	T	7: 10,224,675 (GRCm39)	S141T	probably damaging	Het
Zkscan3	A	G	13: 21,580,305 (GRCm39)	Y128H	possibly damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41,885,390 (GRCm39)	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	41,935,774 (GRCm39)	splice site	probably benign
IGL01545:Sorl1	APN	9	41,955,252 (GRCm39)	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	41,968,565 (GRCm39)	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	41,912,788 (GRCm39)	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41,892,007 (GRCm39)	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	41,915,330 (GRCm39)	missense	probably benign
IGL02215:Sorl1	APN	9	41,929,478 (GRCm39)	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	41,952,986 (GRCm39)	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	41,957,857 (GRCm39)	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	41,975,070 (GRCm39)	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	41,948,355 (GRCm39)	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	41,952,349 (GRCm39)	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	41,968,621 (GRCm39)	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41,902,722 (GRCm39)	missense	probably benign
IGL03288:Sorl1	APN	9	41,944,858 (GRCm39)	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	41,952,892 (GRCm39)	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41,879,918 (GRCm39)	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	41,944,873 (GRCm39)	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	41,979,229 (GRCm39)	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	41,993,250 (GRCm39)	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	41,943,205 (GRCm39)	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	41,915,384 (GRCm39)	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41,902,667 (GRCm39)	missense	probably null	0.00
R0512:Sorl1	UTSW	9	41,979,128 (GRCm39)	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41,895,802 (GRCm39)	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	41,955,196 (GRCm39)	splice site	probably benign
R0831:Sorl1	UTSW	9	41,982,365 (GRCm39)	splice site	probably benign
R0924:Sorl1	UTSW	9	41,919,470 (GRCm39)	splice site	probably benign
R1013:Sorl1	UTSW	9	41,913,855 (GRCm39)	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41,902,752 (GRCm39)	missense	probably benign
R1077:Sorl1	UTSW	9	41,925,786 (GRCm39)	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	41,943,092 (GRCm39)	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	41,911,708 (GRCm39)	splice site	probably null
R1498:Sorl1	UTSW	9	41,952,369 (GRCm39)	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41,907,538 (GRCm39)	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42,001,261 (GRCm39)	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41,902,778 (GRCm39)	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41,881,021 (GRCm39)	nonsense	probably null
R1912:Sorl1	UTSW	9	41,993,246 (GRCm39)	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	41,957,920 (GRCm39)	missense	probably benign
R2071:Sorl1	UTSW	9	41,890,753 (GRCm39)	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41,895,788 (GRCm39)	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41,892,007 (GRCm39)	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	41,948,366 (GRCm39)	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41,881,077 (GRCm39)	missense	probably benign
R3815:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	41,915,401 (GRCm39)	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41,900,764 (GRCm39)	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	41,946,744 (GRCm39)	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	41,915,288 (GRCm39)	nonsense	probably null
R4610:Sorl1	UTSW	9	41,943,210 (GRCm39)	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	41,915,347 (GRCm39)	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	41,915,347 (GRCm39)	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41,895,804 (GRCm39)	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41,903,617 (GRCm39)	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	41,975,048 (GRCm39)	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	41,952,935 (GRCm39)	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	41,925,746 (GRCm39)	splice site	probably null
R4976:Sorl1	UTSW	9	41,894,299 (GRCm39)	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41,902,638 (GRCm39)	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41,907,590 (GRCm39)	missense	probably benign
R5070:Sorl1	UTSW	9	41,943,114 (GRCm39)	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41,887,673 (GRCm39)	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	41,944,879 (GRCm39)	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42,017,812 (GRCm39)	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	41,942,198 (GRCm39)	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41,890,686 (GRCm39)	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	41,968,580 (GRCm39)	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	41,968,580 (GRCm39)	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	41,913,932 (GRCm39)	nonsense	probably null
R5518:Sorl1	UTSW	9	41,948,508 (GRCm39)	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41,902,921 (GRCm39)	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42,003,669 (GRCm39)	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41,894,330 (GRCm39)	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41,881,038 (GRCm39)	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41,887,703 (GRCm39)	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	41,982,530 (GRCm39)	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	41,913,863 (GRCm39)	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	41,912,899 (GRCm39)	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41,891,941 (GRCm39)	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	41,913,863 (GRCm39)	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	41,982,497 (GRCm39)	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	41,982,497 (GRCm39)	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42,003,748 (GRCm39)	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42,010,559 (GRCm39)	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	41,935,694 (GRCm39)	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	41,933,688 (GRCm39)	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	41,944,922 (GRCm39)	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41,881,047 (GRCm39)	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	41,942,279 (GRCm39)	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	41,913,930 (GRCm39)	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42,035,375 (GRCm39)	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	41,948,499 (GRCm39)	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	41,975,006 (GRCm39)	splice site	probably null
R7537:Sorl1	UTSW	9	41,891,984 (GRCm39)	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41,888,878 (GRCm39)	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42,003,630 (GRCm39)	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41,895,822 (GRCm39)	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	41,955,205 (GRCm39)	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42,001,257 (GRCm39)	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41,900,655 (GRCm39)	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41,902,697 (GRCm39)	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41,888,857 (GRCm39)	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41,888,857 (GRCm39)	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	41,979,229 (GRCm39)	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	41,952,857 (GRCm39)	splice site	probably null
R8261:Sorl1	UTSW	9	41,925,777 (GRCm39)	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	41,942,294 (GRCm39)	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	41,929,456 (GRCm39)	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41,903,041 (GRCm39)	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41,903,041 (GRCm39)	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41,885,370 (GRCm39)	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	41,933,722 (GRCm39)	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	41,911,567 (GRCm39)	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	41,957,848 (GRCm39)	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	41,982,491 (GRCm39)	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	41,975,050 (GRCm39)	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41,885,420 (GRCm39)	nonsense	probably null
R9278:Sorl1	UTSW	9	41,957,857 (GRCm39)	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	41,952,927 (GRCm39)	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41,900,739 (GRCm39)	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	41,979,229 (GRCm39)	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	41,912,814 (GRCm39)	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42,035,384 (GRCm39)	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	41,933,631 (GRCm39)	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	41,993,105 (GRCm39)	nonsense	probably null
R9563:Sorl1	UTSW	9	41,957,893 (GRCm39)	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	41,957,893 (GRCm39)	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	41,993,105 (GRCm39)	nonsense	probably null
R9634:Sorl1	UTSW	9	41,907,590 (GRCm39)	missense	probably benign
R9671:Sorl1	UTSW	9	41,943,077 (GRCm39)	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42,003,766 (GRCm39)	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42,035,244 (GRCm39)	missense	probably benign	0.03
Z1176:Sorl1	UTSW	9	42,010,499 (GRCm39)	missense	possibly damaging	0.64
Z1177:Sorl1	UTSW	9	42,017,837 (GRCm39)	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	41,902,934 (GRCm39)	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42,035,208 (GRCm39)	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	41,952,892 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGCTCAAGACGCATATCAGTACCC -3'
(R):5'- GAAGCCATCAGGTCCCTCATTCAG -3'

Sequencing Primer
(F):5'- TAAGTGACTTTCTCTGGCACACAG -3'
(R):5'- AGGTCCCTCATTCAGTGTGTG -3'

Posted On

2014-05-09