Incidental Mutation 'R7385:Vmn2r96'
ID573060
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Namevomeronasal 2, receptor 96
SynonymsEG433070
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R7385 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18573151-18616003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18583040 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 404 (Y404C)
Ref Sequence ENSEMBL: ENSMUSP00000135095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
Predicted Effect probably damaging
Transcript: ENSMUST00000165692
AA Change: Y212C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: Y212C

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177244
AA Change: Y404C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: Y404C

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect probably damaging
Transcript: ENSMUST00000231286
AA Change: Y404C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,287,737 E3146D probably benign Het
4932415D10Rik T C 10: 82,287,895 S3094G probably benign Het
Ahctf1 T C 1: 179,753,381 E1752G possibly damaging Het
Aqp3 T C 4: 41,095,178 T68A probably damaging Het
Arhgap40 A G 2: 158,543,227 K463R probably damaging Het
Asb10 A T 5: 24,533,738 C440* probably null Het
Bach1 A G 16: 87,729,497 T616A probably damaging Het
Braf T A 6: 39,665,108 probably null Het
Cacna1s A T 1: 136,092,633 N803Y probably damaging Het
Cald1 A G 6: 34,686,065 E21G probably damaging Het
Caskin1 G T 17: 24,503,924 G589C probably damaging Het
Cdc37l1 T C 19: 28,990,671 probably null Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col5a1 T C 2: 28,024,750 L1615P unknown Het
Cpt1a C A 19: 3,380,155 P672T probably damaging Het
Defb22 A G 2: 152,486,197 Y23H probably damaging Het
Depdc1b G C 13: 108,363,632 K226N probably damaging Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dsg3 C A 18: 20,540,197 T975K possibly damaging Het
Eif4enif1 T A 11: 3,220,269 D107E probably damaging Het
Fut11 A G 14: 20,696,257 D389G probably damaging Het
Gopc C T 10: 52,349,232 G299E probably damaging Het
Gprin1 T C 13: 54,738,610 D617G probably benign Het
Grin2d A G 7: 45,857,536 V505A probably damaging Het
Heatr6 T C 11: 83,759,335 Y206H probably damaging Het
Hhex C A 19: 37,437,265 N147K probably damaging Het
Igkv4-80 G A 6: 69,016,715 S64F probably damaging Het
Jakmip3 A G 7: 139,023,339 K360R possibly damaging Het
Kat5 AG A 19: 5,608,269 probably null Het
Kat5 T A 19: 5,608,274 N191I probably benign Het
Kifc5b A G 17: 26,925,623 D572G probably damaging Het
Lrp5 C A 19: 3,612,197 probably null Het
Lrtm1 A G 14: 29,027,716 M345V probably benign Het
Mbd5 T C 2: 49,272,449 V981A probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mrgprd A G 7: 145,321,524 N44S probably damaging Het
Mrps10 C A 17: 47,378,221 P181Q probably damaging Het
Myot T A 18: 44,337,008 C17* probably null Het
Ncoa6 C A 2: 155,407,801 L1194F probably damaging Het
Olfr1355 C A 10: 78,879,454 T94K probably damaging Het
Olfr1423 T C 19: 12,035,999 T248A probably benign Het
Olfr1428 T C 19: 12,108,697 N57S probably damaging Het
Olfr1507 T C 14: 52,490,181 Y261C probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Osbpl6 G A 2: 76,549,450 G128E probably damaging Het
P3h3 A T 6: 124,855,270 Y218N probably damaging Het
Paxip1 A G 5: 27,781,420 probably null Het
Pdia5 T C 16: 35,429,914 Y225C probably damaging Het
Pik3c2g T G 6: 139,855,353 M526R Het
Prox1 A G 1: 190,162,126 F41L probably benign Het
Psd3 A T 8: 68,000,756 F284I probably damaging Het
Rev3l T A 10: 39,823,682 C1392S probably benign Het
Rfxank A T 8: 70,134,635 V212E probably damaging Het
Ros1 T C 10: 52,155,126 D482G probably benign Het
Sat2 A T 11: 69,622,937 I94F probably damaging Het
Scarf2 T C 16: 17,803,838 L384P probably damaging Het
Sec14l2 C A 11: 4,116,750 E21* probably null Het
Slitrk5 T A 14: 111,680,699 V585E probably benign Het
Tas2r130 T A 6: 131,630,263 M190L probably benign Het
Ticrr G A 7: 79,691,849 S1061N possibly damaging Het
Tlr9 C A 9: 106,225,264 H585N probably damaging Het
Tmem219 A T 7: 126,896,775 I142N probably damaging Het
Tnni2 A G 7: 142,443,178 N8S probably benign Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc8 A G 12: 98,942,288 E72G possibly damaging Het
Upf1 A G 8: 70,340,618 Y297H probably damaging Het
Vmn1r4 A G 6: 56,956,736 K75R probably damaging Het
Vmn2r78 G A 7: 86,922,425 G481D probably benign Het
Vps50 T A 6: 3,602,708 S942T probably benign Het
Xkr7 C A 2: 153,054,063 S279* probably null Het
Zan G A 5: 137,434,154 Q2294* probably null Het
Zan T C 5: 137,450,491 Y1700C unknown Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18583819 missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18582964 missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18597265 missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18583959 missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18597567 missense probably benign
IGL02672:Vmn2r96 APN 17 18598114 missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18582589 missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18582875 missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18586372 missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18582565 missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18584000 missense probably benign
R0580:Vmn2r96 UTSW 17 18582638 missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18597568 missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18582476 missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18597726 missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18582653 missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18597921 missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18586402 missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18583876 missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18584001 missense probably benign
R2405:Vmn2r96 UTSW 17 18597840 missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18598077 missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18583008 missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18582826 missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18597508 missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18597604 missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18582656 missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18583858 missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18597688 missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18597829 missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18583959 missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18583864 missense probably benign
R6339:Vmn2r96 UTSW 17 18583862 missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18597531 missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18583855 missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18598090 missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18581854 missense probably benign 0.04
R6851:Vmn2r96 UTSW 17 18582538 missense possibly damaging 0.95
R6944:Vmn2r96 UTSW 17 18597629 missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18597838 missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18598021 missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18583820 missense probably benign
R7149:Vmn2r96 UTSW 17 18597727 missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18582767 missense probably benign 0.15
R7442:Vmn2r96 UTSW 17 18573400 missense probably benign 0.02
Z1088:Vmn2r96 UTSW 17 18597366 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTAGACTCATTCCATGGGAGCC -3'
(R):5'- AGATTGCCTAAGTTAGTTGTCTTGC -3'

Sequencing Primer
(F):5'- GGGAGCCTCATTTTTAAGCAC -3'
(R):5'- GCAAATCTCTTATGCCAGAATGCTG -3'
Posted On2019-09-13