Incidental Mutation 'R0675:Myo5c'
ID61615
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission 038860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0675 (G1)
Quality Score175
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75278289 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 978 (M978T)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
AA Change: M978T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: M978T

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (88/91)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,776 E140G probably benign Het
4932431P20Rik T C 7: 29,532,517 noncoding transcript Het
Ablim2 C T 5: 35,866,780 probably benign Het
Aire T C 10: 78,034,493 probably benign Het
Akap12 T C 10: 4,353,315 S42P probably benign Het
Amigo1 T C 3: 108,191,669 probably benign Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Ank1 T A 8: 23,110,384 probably benign Het
Ano5 A T 7: 51,574,810 T472S probably damaging Het
Arid3c T C 4: 41,725,958 D215G probably damaging Het
Cd200 T C 16: 45,397,110 I73V probably benign Het
Cd47 T C 16: 49,906,799 I318T possibly damaging Het
Cep290 A G 10: 100,568,813 probably null Het
Cep350 A G 1: 155,959,753 S66P possibly damaging Het
Cfap46 C T 7: 139,676,034 C300Y probably damaging Het
Chd1 T A 17: 15,758,261 probably benign Het
Chd5 C A 4: 152,385,950 T1913K probably benign Het
Clec4b1 A G 6: 123,071,446 Y180C probably damaging Het
Cntnap5c A T 17: 58,034,995 D227V probably damaging Het
Col19a1 C G 1: 24,575,455 probably benign Het
Csmd1 A T 8: 16,158,131 M1270K probably benign Het
Cyp2c66 T A 19: 39,186,616 F487I possibly damaging Het
Dpp8 T C 9: 65,066,502 probably benign Het
Duoxa1 A T 2: 122,306,380 probably benign Het
Edil3 A G 13: 89,177,280 K263E probably damaging Het
Fat2 A G 11: 55,309,209 L1013P probably damaging Het
Fras1 T C 5: 96,667,387 probably benign Het
Gab1 A G 8: 80,769,668 S668P probably damaging Het
Galnt14 T C 17: 73,545,035 T130A probably damaging Het
Gm10192 G A 4: 97,182,872 H99Y unknown Het
Gm5592 A G 7: 41,289,387 T698A possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gsdma3 A G 11: 98,631,191 K149R probably benign Het
Igkv4-71 A G 6: 69,243,427 S29P probably damaging Het
Igsf10 C T 3: 59,328,594 V1389I probably benign Het
Ik T C 18: 36,747,333 probably benign Het
Ino80 G A 2: 119,383,481 P1203S probably damaging Het
Iqsec2 G A X: 152,204,124 E398K possibly damaging Het
Jmjd6 A G 11: 116,840,527 V232A probably damaging Het
Klhdc9 G A 1: 171,360,327 T112M possibly damaging Het
Marcks A G 10: 37,141,185 probably benign Het
Mctp2 T A 7: 72,083,170 T829S probably damaging Het
Mroh2a C A 1: 88,228,380 A78E probably damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Mtmr14 A T 6: 113,270,647 H518L probably damaging Het
Mum1 T A 10: 80,230,080 V56E probably damaging Het
Nlrc3 T C 16: 3,948,911 I1015V probably benign Het
Nlrp5 C A 7: 23,417,417 Q189K possibly damaging Het
Olfr1082 T C 2: 86,594,079 I250V probably benign Het
Olfr385 A C 11: 73,589,252 L162R probably damaging Het
Olfr583 A G 7: 103,051,702 I135V probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Otof T A 5: 30,382,361 Y1051F probably benign Het
Pcdhb14 C A 18: 37,448,339 T166K possibly damaging Het
Pla2g4e A G 2: 120,200,198 probably benign Het
Polr3gl T C 3: 96,582,155 E20G probably damaging Het
Psmd1 A G 1: 86,082,039 D295G probably benign Het
Ptpn21 C A 12: 98,688,216 A831S probably benign Het
Rd3l T C 12: 111,980,162 D60G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,441,834 D2624G probably benign Het
Sec31a T C 5: 100,393,207 D347G probably damaging Het
Sema4g G A 19: 44,997,587 R289H probably damaging Het
Sema5b C T 16: 35,660,333 T761I probably benign Het
Sept1 A T 7: 127,216,999 F86L probably damaging Het
Shank3 T C 15: 89,531,388 V627A possibly damaging Het
Slc25a46 C A 18: 31,609,588 G75V probably benign Het
Slc45a2 T A 15: 11,025,778 Y405N probably damaging Het
Spidr T C 16: 16,037,634 E339G probably damaging Het
Sptbn1 A T 11: 30,117,903 H1770Q probably damaging Het
Srgap1 T C 10: 121,792,235 Y944C probably damaging Het
Supt20 C T 3: 54,706,969 T169I probably damaging Het
Tie1 G A 4: 118,479,769 Q587* probably null Het
Tmem214 A G 5: 30,871,825 T203A possibly damaging Het
Tmprss15 C A 16: 78,985,950 S742I probably damaging Het
Zfhx2 A G 14: 55,063,163 V2377A probably damaging Het
Zfp763 G A 17: 33,019,800 H124Y possibly damaging Het
Zfp846 T C 9: 20,593,557 S238P probably benign Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGAAGTCCCCTTGGGTCCCTG -3'
(R):5'- GTGCCCCTTTAGTCTACATGCTGG -3'

Sequencing Primer
(F):5'- CAGACTGTTAATACTGGCTGAGC -3'
(R):5'- cacacacactcatacacacatc -3'
Posted On2013-07-30