Mutagenetix > Incidental Mutation

Incidental Mutation 'R7040:Mme'

546984

Institutional Source

Beutler Lab

Gene Symbol

Mme

Ensembl Gene

ENSMUSG00000027820

Gene Name

membrane metallo endopeptidase

Synonyms

CD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik

MMRRC Submission

045013-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7040 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63241537-63386030 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63368923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 707 (I707N)

Ref Sequence

ENSEMBL: ENSMUSP00000141544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]

AlphaFold

Q61391

Predicted Effect

probably damaging
Transcript: ENSMUST00000029400
AA Change: I707N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: I707N

Domain	Start	End	E-Value	Type
PDB:2YVC\|F	2	23	5e-7	PDB
transmembrane domain	29	51	N/A	INTRINSIC
Pfam:Peptidase_M13_N	80	483	8.7e-103	PFAM
low complexity region	489	507	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
Pfam:Peptidase_M13	543	749	5.8e-75	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000194134
AA Change: I707N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: I707N

Domain	Start	End	E-Value	Type
PDB:2YVC\|F	2	23	5e-7	PDB
transmembrane domain	29	51	N/A	INTRINSIC
Pfam:Peptidase_M13_N	80	483	8.4e-134	PFAM
low complexity region	489	507	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
Pfam:Peptidase_M13	543	749	3.3e-67	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000194150
AA Change: I707N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: I707N

Domain	Start	End	E-Value	Type
PDB:2YVC\|F	2	23	5e-7	PDB
transmembrane domain	29	51	N/A	INTRINSIC
Pfam:Peptidase_M13_N	80	483	8.4e-134	PFAM
low complexity region	489	507	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
Pfam:Peptidase_M13	543	749	3.3e-67	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	A	G	7: 128,236,725	L232P	possibly damaging	Het
Acaa1a	T	C	9: 119,349,038	V312A	probably damaging	Het
Bmp2	A	G	2: 133,561,684	D385G	probably damaging	Het
C1qtnf9	T	C	14: 60,779,792	V257A	probably damaging	Het
Cd3d	G	A	9: 44,985,693	V122I	probably damaging	Het
Cdc37	T	C	9: 21,142,223	E199G	probably damaging	Het
Crb2	T	A	2: 37,787,684	D326E	probably benign	Het
Cyp2c29	A	C	19: 39,330,337	K420N	possibly damaging	Het
Cyp2g1	A	C	7: 26,820,759	D472A	probably damaging	Het
Dab2	A	C	15: 6,422,251	H116P	probably damaging	Het
Dnah7b	G	C	1: 46,236,809	E2619Q	probably benign	Het
Dsg4	A	T	18: 20,451,852	M208L	probably benign	Het
Eif4enif1	T	G	11: 3,234,040	V521G	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fpr-rs6	A	G	17: 20,182,934	M55T	probably damaging	Het
Grhpr	A	G	4: 44,985,362	S101G	probably damaging	Het
Kif15	T	A	9: 123,011,614	D33E	possibly damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lama4	A	G	10: 39,060,162	Q611R	possibly damaging	Het
Lrrc47	T	A	4: 154,020,452	*123R	probably null	Het
Map4k3	A	C	17: 80,680,915	V36G	probably damaging	Het
Muc2	A	G	7: 141,751,457	E166G	unknown	Het
Mucl1	T	A	15: 103,753,578	T108S	possibly damaging	Het
Myo1h	A	T	5: 114,359,744	D53V	possibly damaging	Het
Naa15	T	A	3: 51,472,784	L811Q	possibly damaging	Het
Nalcn	T	C	14: 123,287,855	T1487A	probably benign	Het
Nme8	A	T	13: 19,694,328	L87H	probably damaging	Het
Nr2e1	A	G	10: 42,568,378	V245A	probably damaging	Het
Nt5c2	A	T	19: 46,893,535	F291Y	possibly damaging	Het
Olfr1337	T	C	4: 118,781,986	M200V	probably benign	Het
Olfr1508	T	C	14: 52,463,475	D178G	possibly damaging	Het
Olfr556	A	T	7: 102,670,730	Q270L	probably benign	Het
Olfr668	A	T	7: 104,925,510	C85S	probably benign	Het
Ooep	T	C	9: 78,378,401	N43S	possibly damaging	Het
Ovch2	A	T	7: 107,796,565	I82N	probably damaging	Het
Palb2	A	T	7: 122,114,399	M524K	possibly damaging	Het
Patj	T	C	4: 98,441,080	S524P	probably benign	Het
Patl1	T	A	19: 11,929,954	Y401N	possibly damaging	Het
Pcdhb20	A	T	18: 37,504,717	T99S	probably benign	Het
Plcb4	G	A	2: 135,932,262	A155T	probably benign	Het
Rpap3	A	G	15: 97,679,112	V585A	possibly damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spen	T	A	4: 141,494,382	T302S	unknown	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Ube2o	T	C	11: 116,541,860	E760G	probably benign	Het
Uimc1	T	A	13: 55,075,454		probably null	Het
Usp16	C	T	16: 87,480,929	A689V	probably damaging	Het
Vmn2r60	G	A	7: 42,142,242	A530T	probably benign	Het
Vps8	T	A	16: 21,575,022	M1185K	probably damaging	Het
Vwa8	T	C	14: 78,912,205	S136P	probably damaging	Het
Ythdc2	A	G	18: 44,834,462	N175S	probably benign	Het
Zfp160	A	T	17: 21,026,532	H448L	probably damaging	Het
Zfp90	T	A	8: 106,425,009	C451*	probably null	Het
Zfp945	A	G	17: 22,852,290	C212R	probably damaging	Het

Other mutations in Mme

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Mme	APN	3	63340044	missense	possibly damaging	0.95
IGL00329:Mme	APN	3	63380328	nonsense	probably null
IGL01013:Mme	APN	3	63327860	splice site	probably null
IGL01316:Mme	APN	3	63340159	splice site	probably benign
IGL01333:Mme	APN	3	63346091	missense	probably damaging	1.00
IGL01392:Mme	APN	3	63362046	missense	probably damaging	1.00
IGL01566:Mme	APN	3	63361929	splice site	probably benign
IGL01739:Mme	APN	3	63340113	missense	possibly damaging	0.78
IGL01996:Mme	APN	3	63343549	missense	probably benign	0.11
IGL02125:Mme	APN	3	63348649	missense	probably damaging	1.00
IGL02154:Mme	APN	3	63343555	missense	probably benign
IGL03214:Mme	APN	3	63329690	missense	possibly damaging	0.72
IGL03291:Mme	APN	3	63346104	missense	probably benign	0.00
R0498:Mme	UTSW	3	63346066	missense	probably damaging	1.00
R0595:Mme	UTSW	3	63328181	missense	probably benign	0.27
R0980:Mme	UTSW	3	63340129	missense	probably benign
R1210:Mme	UTSW	3	63343606	missense	probably benign	0.01
R1600:Mme	UTSW	3	63365058	missense	probably damaging	1.00
R1852:Mme	UTSW	3	63327983	missense	probably benign	0.31
R1852:Mme	UTSW	3	63328046	missense	probably benign	0.00
R2037:Mme	UTSW	3	63328260	missense	probably null	1.00
R2177:Mme	UTSW	3	63301005	missense	probably benign	0.02
R2200:Mme	UTSW	3	63380292	missense	possibly damaging	0.87
R2306:Mme	UTSW	3	63300252	missense	probably benign	0.00
R2847:Mme	UTSW	3	63345199	missense	possibly damaging	0.91
R3008:Mme	UTSW	3	63358957	missense	probably damaging	1.00
R3749:Mme	UTSW	3	63343540	missense	probably damaging	1.00
R3876:Mme	UTSW	3	63362059	splice site	probably benign
R3961:Mme	UTSW	3	63345192	missense	probably damaging	1.00
R3981:Mme	UTSW	3	63328064	missense	probably damaging	1.00
R3982:Mme	UTSW	3	63328064	missense	probably damaging	1.00
R3983:Mme	UTSW	3	63328064	missense	probably damaging	1.00
R4494:Mme	UTSW	3	63347192	missense	probably benign
R4589:Mme	UTSW	3	63380272	missense	probably benign
R4706:Mme	UTSW	3	63348712	missense	possibly damaging	0.92
R4871:Mme	UTSW	3	63340032	missense	probably benign	0.01
R4957:Mme	UTSW	3	63343489	splice site	probably benign
R5053:Mme	UTSW	3	63364849	missense	probably damaging	1.00
R5316:Mme	UTSW	3	63368954	missense	probably damaging	1.00
R5502:Mme	UTSW	3	63300281	nonsense	probably null
R5579:Mme	UTSW	3	63348645	missense	probably damaging	1.00
R6007:Mme	UTSW	3	63343508	nonsense	probably null
R6022:Mme	UTSW	3	63364797	missense	probably damaging	1.00
R6143:Mme	UTSW	3	63300111	splice site	probably null
R6154:Mme	UTSW	3	63300253	missense	probably damaging	0.98
R6333:Mme	UTSW	3	63341961	missense	probably benign	0.00
R6476:Mme	UTSW	3	63343635	critical splice donor site	probably null
R6514:Mme	UTSW	3	63364844	nonsense	probably null
R6711:Mme	UTSW	3	63341918	missense	possibly damaging	0.93
R6842:Mme	UTSW	3	63362044	missense	probably damaging	1.00
R6996:Mme	UTSW	3	63346102	missense	possibly damaging	0.63
R7043:Mme	UTSW	3	63345217	nonsense	probably null
R7084:Mme	UTSW	3	63328217	missense	probably damaging	0.98
R7126:Mme	UTSW	3	63368901	missense	probably damaging	0.97
R7783:Mme	UTSW	3	63364867	missense	probably damaging	1.00
R8501:Mme	UTSW	3	63326735	missense	probably damaging	1.00
R8857:Mme	UTSW	3	63348649	missense	probably damaging	1.00
R9453:Mme	UTSW	3	63364885	missense	possibly damaging	0.90
R9556:Mme	UTSW	3	63364804	missense	probably damaging	0.97
R9648:Mme	UTSW	3	63301005	missense	probably benign	0.02
X0058:Mme	UTSW	3	63365021	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTTCTGGATGCCTTTCAATGTAC -3'
(R):5'- ACCCAATGTGATCTGTTGAGTC -3'

Sequencing Primer
(F):5'- GGATGCCTTTCAATGTACATTATTTG -3'
(R):5'- TGCACTGATACACATGTGCAC -3'

Posted On

2019-05-13