Incidental Mutation 'R7040:Mme'
ID 546984
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Name membrane metallo endopeptidase
Synonyms CD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 63241537-63386030 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63368923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 707 (I707N)
Ref Sequence ENSEMBL: ENSMUSP00000141544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]
AlphaFold Q61391
Predicted Effect probably damaging
Transcript: ENSMUST00000029400
AA Change: I707N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: I707N

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194134
AA Change: I707N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: I707N

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194150
AA Change: I707N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: I707N

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63340044 missense possibly damaging 0.95
IGL00329:Mme APN 3 63380328 nonsense probably null
IGL01013:Mme APN 3 63327860 splice site probably null
IGL01316:Mme APN 3 63340159 splice site probably benign
IGL01333:Mme APN 3 63346091 missense probably damaging 1.00
IGL01392:Mme APN 3 63362046 missense probably damaging 1.00
IGL01566:Mme APN 3 63361929 splice site probably benign
IGL01739:Mme APN 3 63340113 missense possibly damaging 0.78
IGL01996:Mme APN 3 63343549 missense probably benign 0.11
IGL02125:Mme APN 3 63348649 missense probably damaging 1.00
IGL02154:Mme APN 3 63343555 missense probably benign
IGL03214:Mme APN 3 63329690 missense possibly damaging 0.72
IGL03291:Mme APN 3 63346104 missense probably benign 0.00
R0498:Mme UTSW 3 63346066 missense probably damaging 1.00
R0595:Mme UTSW 3 63328181 missense probably benign 0.27
R0980:Mme UTSW 3 63340129 missense probably benign
R1210:Mme UTSW 3 63343606 missense probably benign 0.01
R1600:Mme UTSW 3 63365058 missense probably damaging 1.00
R1852:Mme UTSW 3 63327983 missense probably benign 0.31
R1852:Mme UTSW 3 63328046 missense probably benign 0.00
R2037:Mme UTSW 3 63328260 missense probably null 1.00
R2177:Mme UTSW 3 63301005 missense probably benign 0.02
R2200:Mme UTSW 3 63380292 missense possibly damaging 0.87
R2306:Mme UTSW 3 63300252 missense probably benign 0.00
R2847:Mme UTSW 3 63345199 missense possibly damaging 0.91
R3008:Mme UTSW 3 63358957 missense probably damaging 1.00
R3749:Mme UTSW 3 63343540 missense probably damaging 1.00
R3876:Mme UTSW 3 63362059 splice site probably benign
R3961:Mme UTSW 3 63345192 missense probably damaging 1.00
R3981:Mme UTSW 3 63328064 missense probably damaging 1.00
R3982:Mme UTSW 3 63328064 missense probably damaging 1.00
R3983:Mme UTSW 3 63328064 missense probably damaging 1.00
R4494:Mme UTSW 3 63347192 missense probably benign
R4589:Mme UTSW 3 63380272 missense probably benign
R4706:Mme UTSW 3 63348712 missense possibly damaging 0.92
R4871:Mme UTSW 3 63340032 missense probably benign 0.01
R4957:Mme UTSW 3 63343489 splice site probably benign
R5053:Mme UTSW 3 63364849 missense probably damaging 1.00
R5316:Mme UTSW 3 63368954 missense probably damaging 1.00
R5502:Mme UTSW 3 63300281 nonsense probably null
R5579:Mme UTSW 3 63348645 missense probably damaging 1.00
R6007:Mme UTSW 3 63343508 nonsense probably null
R6022:Mme UTSW 3 63364797 missense probably damaging 1.00
R6143:Mme UTSW 3 63300111 splice site probably null
R6154:Mme UTSW 3 63300253 missense probably damaging 0.98
R6333:Mme UTSW 3 63341961 missense probably benign 0.00
R6476:Mme UTSW 3 63343635 critical splice donor site probably null
R6514:Mme UTSW 3 63364844 nonsense probably null
R6711:Mme UTSW 3 63341918 missense possibly damaging 0.93
R6842:Mme UTSW 3 63362044 missense probably damaging 1.00
R6996:Mme UTSW 3 63346102 missense possibly damaging 0.63
R7043:Mme UTSW 3 63345217 nonsense probably null
R7084:Mme UTSW 3 63328217 missense probably damaging 0.98
R7126:Mme UTSW 3 63368901 missense probably damaging 0.97
R7783:Mme UTSW 3 63364867 missense probably damaging 1.00
R8501:Mme UTSW 3 63326735 missense probably damaging 1.00
R8857:Mme UTSW 3 63348649 missense probably damaging 1.00
X0058:Mme UTSW 3 63365021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCTGGATGCCTTTCAATGTAC -3'
(R):5'- ACCCAATGTGATCTGTTGAGTC -3'

Sequencing Primer
(F):5'- GGATGCCTTTCAATGTACATTATTTG -3'
(R):5'- TGCACTGATACACATGTGCAC -3'
Posted On 2019-05-13