Incidental Mutation 'R1291:C130060K24Rik'
ID150784
Institutional Source Beutler Lab
Gene Symbol C130060K24Rik
Ensembl Gene ENSMUSG00000029917
Gene NameRIKEN cDNA C130060K24 gene
Synonyms
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location65381105-65458150 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 65452900 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 193 (Y193*)
Ref Sequence ENSEMBL: ENSMUSP00000130225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133352] [ENSMUST00000170608]
Predicted Effect probably null
Transcript: ENSMUST00000133352
AA Change: Y140*
SMART Domains Protein: ENSMUSP00000122416
Gene: ENSMUSG00000029917
AA Change: Y140*

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 113 1.2e-7 PFAM
Pfam:7tm_1 61 122 1.3e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136016
AA Change: Y84*
SMART Domains Protein: ENSMUSP00000121875
Gene: ENSMUSG00000029917
AA Change: Y84*

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170608
AA Change: Y193*
SMART Domains Protein: ENSMUSP00000130225
Gene: ENSMUSG00000029917
AA Change: Y193*

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 346 2.5e-5 PFAM
Pfam:7tm_1 61 331 7.2e-56 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in C130060K24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:C130060K24Rik APN 6 65381610 missense probably benign 0.36
IGL03335:C130060K24Rik APN 6 65453117 critical splice donor site probably null
R1689:C130060K24Rik UTSW 6 65381607 missense possibly damaging 0.84
R1705:C130060K24Rik UTSW 6 65456306 missense probably benign 0.01
R2188:C130060K24Rik UTSW 6 65441276 missense probably damaging 0.97
R3955:C130060K24Rik UTSW 6 65453108 missense possibly damaging 0.73
R4058:C130060K24Rik UTSW 6 65381541 missense probably damaging 1.00
R4572:C130060K24Rik UTSW 6 65454991 missense probably benign 0.06
R4597:C130060K24Rik UTSW 6 65447424 critical splice donor site probably null
R4756:C130060K24Rik UTSW 6 65452914 missense probably benign 0.02
R5139:C130060K24Rik UTSW 6 65456219 missense probably damaging 0.98
R5872:C130060K24Rik UTSW 6 65441385 intron probably benign
R6193:C130060K24Rik UTSW 6 65456158 missense probably damaging 1.00
R6305:C130060K24Rik UTSW 6 65454991 missense probably benign 0.06
R6423:C130060K24Rik UTSW 6 65456093 missense probably benign 0.01
R6453:C130060K24Rik UTSW 6 65453030 missense possibly damaging 0.71
R6677:C130060K24Rik UTSW 6 65456245 missense probably benign
R6744:C130060K24Rik UTSW 6 65441340 missense possibly damaging 0.88
R6793:C130060K24Rik UTSW 6 65381421 missense probably benign 0.20
R6875:C130060K24Rik UTSW 6 65456336 missense probably benign 0.21
R6941:C130060K24Rik UTSW 6 65447401 missense probably damaging 1.00
R6995:C130060K24Rik UTSW 6 65441301 missense probably damaging 1.00
R7063:C130060K24Rik UTSW 6 65441403 intron probably benign
R7564:C130060K24Rik UTSW 6 65452907 nonsense probably null
R7699:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7700:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7711:C130060K24Rik UTSW 6 65441373 missense
R7799:C130060K24Rik UTSW 6 65456137 missense possibly damaging 0.78
R7801:C130060K24Rik UTSW 6 65441217 missense probably damaging 1.00
RF018:C130060K24Rik UTSW 6 65456190 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAAATCCAGCAGCAGCTCGC -3'
(R):5'- AATTACCCAGGTAGCCCCTTCCAG -3'

Sequencing Primer
(F):5'- AGCAGCAGCTCGCATCTG -3'
(R):5'- TCCATGAATAGTTCGGAGCACTG -3'
Posted On2014-01-29