Incidental Mutation 'R1291:Srp68'
ID150792
Institutional Source Beutler Lab
Gene Symbol Srp68
Ensembl Gene ENSMUSG00000020780
Gene Namesignal recognition particle 68
Synonyms2610024I03Rik
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116245166-116274217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116263281 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 154 (L154H)
Ref Sequence ENSEMBL: ENSMUSP00000102033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021133] [ENSMUST00000106425]
Predicted Effect probably damaging
Transcript: ENSMUST00000021133
AA Change: L192H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021133
Gene: ENSMUSG00000020780
AA Change: L192H

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SRP68 74 596 5.5e-156 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106425
AA Change: L154H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102033
Gene: ENSMUSG00000020780
AA Change: L154H

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
PDB:4P3F|B 46 215 1e-112 PDB
Blast:TPR 149 182 5e-15 BLAST
Blast:TPR 424 457 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128808
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the signal recognition particle (SRP). The SRP is a ribonucleoprotein complex that transports secreted and membrane proteins to the endoplasmic reticulum for processing. The complex includes a 7S RNA and six protein subunits. The encoded protein is the 68kDa component of the SRP, and forms a heterodimer with the 72kDa subunit that is required for SRP function. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and three pseudogenes of this gene are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in Srp68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Srp68 APN 11 116247812 splice site probably benign
IGL02974:Srp68 APN 11 116246225 missense probably benign 0.31
tipsy UTSW 11 116245812 missense probably damaging 1.00
P0028:Srp68 UTSW 11 116260920 missense probably damaging 0.99
R0211:Srp68 UTSW 11 116265551 missense probably damaging 1.00
R0211:Srp68 UTSW 11 116265551 missense probably damaging 1.00
R0468:Srp68 UTSW 11 116248764 missense probably damaging 0.98
R0796:Srp68 UTSW 11 116246683 missense probably benign 0.12
R1906:Srp68 UTSW 11 116250761 missense probably damaging 1.00
R2149:Srp68 UTSW 11 116260867 missense possibly damaging 0.93
R3732:Srp68 UTSW 11 116273956 nonsense probably null
R4651:Srp68 UTSW 11 116274014 missense probably benign
R4652:Srp68 UTSW 11 116274014 missense probably benign
R4686:Srp68 UTSW 11 116265401 missense probably damaging 0.98
R4924:Srp68 UTSW 11 116260858 missense probably damaging 1.00
R5077:Srp68 UTSW 11 116245812 missense probably damaging 1.00
R5095:Srp68 UTSW 11 116248747 missense probably damaging 0.98
R5166:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5167:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5168:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5769:Srp68 UTSW 11 116246669 missense probably damaging 1.00
R6379:Srp68 UTSW 11 116265401 missense probably damaging 1.00
R6577:Srp68 UTSW 11 116265464 missense probably damaging 1.00
R6777:Srp68 UTSW 11 116262904 missense probably damaging 1.00
R7089:Srp68 UTSW 11 116271907 splice site probably null
R7561:Srp68 UTSW 11 116248767 missense probably damaging 0.99
R7823:Srp68 UTSW 11 116265439 missense probably damaging 1.00
Z1088:Srp68 UTSW 11 116274035 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACACAGCCTGCTCCTCTGTGAATG -3'
(R):5'- AGAACACTGGGTCTTTGTGCTGAG -3'

Sequencing Primer
(F):5'- CATCTGCTGAGTACCAGGAG -3'
(R):5'- AGGCAGTTCTTTGTgggctaag -3'
Posted On2014-01-29