Incidental Mutation 'R1310:Pde4c'
ID157906
Institutional Source Beutler Lab
Gene Symbol Pde4c
Ensembl Gene ENSMUSG00000031842
Gene Namephosphodiesterase 4C, cAMP specific
SynonymsE130301F19Rik, dunce, Dpde1
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1310 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70723720-70751186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70749923 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 592 (D592G)
Ref Sequence ENSEMBL: ENSMUSP00000034307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034301] [ENSMUST00000034307] [ENSMUST00000110090] [ENSMUST00000110093] [ENSMUST00000110095] [ENSMUST00000123739] [ENSMUST00000143118] [ENSMUST00000224874]
Predicted Effect probably benign
Transcript: ENSMUST00000034301
SMART Domains Protein: ENSMUSP00000034301
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000034307
AA Change: D592G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034307
Gene: ENSMUSG00000031842
AA Change: D592G

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
HDc 386 512 1.48e0 SMART
Pfam:PDEase_I 526 598 5.3e-21 PFAM
low complexity region 625 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110090
SMART Domains Protein: ENSMUSP00000105717
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110093
SMART Domains Protein: ENSMUSP00000105720
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110095
AA Change: D626G

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105722
Gene: ENSMUSG00000031842
AA Change: D626G

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
HDc 386 561 5.11e-6 SMART
low complexity region 659 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123739
SMART Domains Protein: ENSMUSP00000119312
Gene: ENSMUSG00000031842

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134693
Predicted Effect probably benign
Transcript: ENSMUST00000143118
SMART Domains Protein: ENSMUSP00000123384
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
Pfam:Miro 1 43 2.5e-6 PFAM
Pfam:Ras 1 62 3.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149272
Predicted Effect possibly damaging
Transcript: ENSMUST00000224874
AA Change: D586G

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Pde4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01938:Pde4c APN 8 70749378 missense probably damaging 1.00
IGL02052:Pde4c APN 8 70748413 missense probably damaging 0.99
IGL02484:Pde4c APN 8 70748052 splice site probably benign
IGL02567:Pde4c APN 8 70747921 missense probably benign 0.11
IGL03355:Pde4c APN 8 70746595 missense probably damaging 1.00
coffee UTSW 8 70745329 missense probably damaging 0.99
tea UTSW 8 70748972 missense possibly damaging 0.67
R0396:Pde4c UTSW 8 70750076 missense probably benign
R1103:Pde4c UTSW 8 70748417 missense probably damaging 1.00
R1161:Pde4c UTSW 8 70749923 missense possibly damaging 0.90
R1420:Pde4c UTSW 8 70748417 missense probably damaging 1.00
R1456:Pde4c UTSW 8 70746613 missense probably benign 0.42
R1586:Pde4c UTSW 8 70746859 missense probably damaging 1.00
R1817:Pde4c UTSW 8 70726989 missense probably benign
R1818:Pde4c UTSW 8 70726989 missense probably benign
R1843:Pde4c UTSW 8 70747950 missense probably damaging 1.00
R1984:Pde4c UTSW 8 70724542 missense probably damaging 1.00
R2001:Pde4c UTSW 8 70747358 unclassified probably null
R2088:Pde4c UTSW 8 70749356 missense possibly damaging 0.88
R4334:Pde4c UTSW 8 70749826 splice site probably null
R5369:Pde4c UTSW 8 70750105 makesense probably null
R5521:Pde4c UTSW 8 70747382 critical splice donor site probably null
R6168:Pde4c UTSW 8 70750039 missense probably benign 0.01
R6749:Pde4c UTSW 8 70746010 missense probably damaging 1.00
R7197:Pde4c UTSW 8 70745329 missense probably damaging 0.99
R7426:Pde4c UTSW 8 70748972 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GAATTCCAGGCTGAGAACACCAGG -3'
(R):5'- GTGGAACGTCATCAGTGCCCATAG -3'

Sequencing Primer
(F):5'- TGATCACCCTAAGGTGGGAT -3'
(R):5'- CTCTTGTTGGACAAAGCAGAC -3'
Posted On2014-02-18