Incidental Mutation 'R1310:Olfr644'
ID157905
Institutional Source Beutler Lab
Gene Symbol Olfr644
Ensembl Gene ENSMUSG00000110012
Gene Nameolfactory receptor 644
SynonymsGA_x6K02T2PBJ9-6803062-6802118, MOR13-1
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R1310 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104066289-104071869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104068598 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 144 (M144I)
Ref Sequence ENSEMBL: ENSMUSP00000149600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077417] [ENSMUST00000138055] [ENSMUST00000213184] [ENSMUST00000213991]
Predicted Effect probably benign
Transcript: ENSMUST00000077417
AA Change: M144I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076633
Gene: ENSMUSG00000110012
AA Change: M144I

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2e-122 PFAM
Pfam:7TM_GPCR_Srsx 37 256 5.9e-8 PFAM
Pfam:7tm_1 43 294 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213184
AA Change: M144I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213991
AA Change: M144I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Olfr644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Olfr644 APN 7 104068369 missense probably benign 0.00
IGL02937:Olfr644 APN 7 104068849 missense probably damaging 0.99
IGL03188:Olfr644 APN 7 104068738 missense possibly damaging 0.89
FR4737:Olfr644 UTSW 7 104071292 start gained probably benign
R0467:Olfr644 UTSW 7 104068125 missense probably benign 0.07
R1457:Olfr644 UTSW 7 104068459 missense probably damaging 1.00
R1619:Olfr644 UTSW 7 104068531 missense probably damaging 1.00
R1874:Olfr644 UTSW 7 104068129 missense probably null 1.00
R2428:Olfr644 UTSW 7 104068468 nonsense probably null
R2922:Olfr644 UTSW 7 104068587 missense probably benign 0.09
R2923:Olfr644 UTSW 7 104068587 missense probably benign 0.09
R3929:Olfr644 UTSW 7 104068584 missense probably benign 0.06
R4500:Olfr644 UTSW 7 104068195 missense probably damaging 1.00
R5035:Olfr644 UTSW 7 104068407 missense possibly damaging 0.95
R5303:Olfr644 UTSW 7 104069032 utr 5 prime probably benign
R5464:Olfr644 UTSW 7 104068467 missense possibly damaging 0.72
R5722:Olfr644 UTSW 7 104068723 missense probably damaging 1.00
R5742:Olfr644 UTSW 7 104068205 missense probably damaging 0.97
R6874:Olfr644 UTSW 7 104068189 missense possibly damaging 0.50
R6940:Olfr644 UTSW 7 104068413 missense possibly damaging 0.82
R7848:Olfr644 UTSW 7 104068095 missense probably benign
R7931:Olfr644 UTSW 7 104068095 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTGCAGAATCCAGCCCAAAG -3'
(R):5'- GCTGTCAGGAAATGACCTTGGTGTG -3'

Sequencing Primer
(F):5'- TCCAGCCCAAAGGTAGAGATG -3'
(R):5'- ACTGCCTACAGTTCTGGGAG -3'
Posted On2014-02-18