Incidental Mutation 'R1456:Colgalt2'
ID 161754
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Name collagen beta(1-O)galactosyltransferase 2
Synonyms Glt25d2
MMRRC Submission 039511-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R1456 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 152275581-152386446 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 152360655 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 231 (V231I)
Ref Sequence ENSEMBL: ENSMUSP00000119210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
AlphaFold Q6NVG7
Predicted Effect probably damaging
Transcript: ENSMUST00000044311
AA Change: V231I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: V231I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127586
AA Change: V231I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649
AA Change: V231I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Meta Mutation Damage Score 0.2797 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,485,731 (GRCm39) probably null Het
4932414N04Rik A T 2: 68,546,558 (GRCm39) E80V possibly damaging Het
Alkbh3 A G 2: 93,831,764 (GRCm39) probably null Het
Ankar A T 1: 72,704,277 (GRCm39) Y664N probably benign Het
Arhgap18 T C 10: 26,792,436 (GRCm39) I629T probably benign Het
Arhgef28 C T 13: 98,211,510 (GRCm39) E158K probably benign Het
Asxl2 C T 12: 3,551,872 (GRCm39) H1205Y possibly damaging Het
Birc6 A G 17: 74,916,285 (GRCm39) I427V probably benign Het
Camk4 A G 18: 33,262,896 (GRCm39) probably benign Het
Ccdc178 A T 18: 22,283,481 (GRCm39) D16E possibly damaging Het
Cct6b G T 11: 82,644,446 (GRCm39) probably benign Het
Ccz1 A G 5: 143,947,836 (GRCm39) probably benign Het
Cdh23 T C 10: 60,322,899 (GRCm39) N335S possibly damaging Het
Cemip T A 7: 83,647,718 (GRCm39) S121C possibly damaging Het
Cers1 A G 8: 70,783,838 (GRCm39) E262G probably damaging Het
Clec11a G T 7: 43,955,874 (GRCm39) P58T possibly damaging Het
Clec16a T C 16: 10,509,419 (GRCm39) I797T probably damaging Het
Col4a1 A C 8: 11,292,829 (GRCm39) probably benign Het
D430041D05Rik G T 2: 104,038,428 (GRCm39) N1580K probably damaging Het
Dcdc5 A G 2: 106,181,910 (GRCm39) noncoding transcript Het
Ddx17 T C 15: 79,414,577 (GRCm39) D530G probably benign Het
Dhx9 A T 1: 153,341,441 (GRCm39) D601E probably benign Het
Dnah3 A G 7: 119,646,853 (GRCm39) Y1059H probably damaging Het
Dtx1 C A 5: 120,848,569 (GRCm39) probably benign Het
Egfr A G 11: 16,813,065 (GRCm39) S182G probably benign Het
Fads1 A G 19: 10,163,116 (GRCm39) N131S probably benign Het
Fam243 T A 16: 92,117,553 (GRCm39) Y245F probably damaging Het
Fancm C T 12: 65,165,125 (GRCm39) A1490V possibly damaging Het
Fsd2 C A 7: 81,209,339 (GRCm39) E168* probably null Het
Galnt2l T C 8: 123,568,687 (GRCm39) probably benign Het
Gm9772 A T 17: 22,226,099 (GRCm39) C62S probably damaging Het
H60c C T 10: 3,210,307 (GRCm39) A81T possibly damaging Het
Hira T G 16: 18,744,413 (GRCm39) S377A probably benign Het
Iffo1 T C 6: 125,122,877 (GRCm39) S220P possibly damaging Het
Itih4 A G 14: 30,614,610 (GRCm39) M491V probably benign Het
Khdrbs2 T C 1: 32,559,777 (GRCm39) R102G possibly damaging Het
Klhdc7a T G 4: 139,692,835 (GRCm39) Y704S possibly damaging Het
Klk1b21 G A 7: 43,754,923 (GRCm39) V73I probably benign Het
Krt42 G A 11: 100,160,435 (GRCm39) A88V probably benign Het
Krt42 C T 11: 100,160,436 (GRCm39) A88T probably benign Het
Limk1 G T 5: 134,686,364 (GRCm39) D580E probably benign Het
Lipk C T 19: 34,024,185 (GRCm39) P323S probably damaging Het
Lipo5 T A 19: 33,443,273 (GRCm39) probably benign Het
Llgl2 A G 11: 115,736,325 (GRCm39) D166G probably benign Het
Mapk8ip3 A T 17: 25,125,923 (GRCm39) N439K probably damaging Het
Mapkbp1 C T 2: 119,803,626 (GRCm39) R32W probably damaging Het
Med23 T A 10: 24,779,550 (GRCm39) probably benign Het
Mrgprb1 A T 7: 48,097,777 (GRCm39) M45K probably damaging Het
Mroh7 G A 4: 106,552,338 (GRCm39) probably benign Het
Mrpl27 G A 11: 94,544,659 (GRCm39) probably benign Het
Ms4a10 T A 19: 10,942,097 (GRCm39) T175S possibly damaging Het
Muc17 T C 5: 137,166,799 (GRCm39) H330R probably benign Het
Myo15a A T 11: 60,399,028 (GRCm39) I2787F probably damaging Het
Ndst1 A G 18: 60,846,277 (GRCm39) C11R possibly damaging Het
Obsl1 C A 1: 75,464,300 (GRCm39) G1669* probably null Het
Or5p56 A G 7: 107,589,605 (GRCm39) E11G probably benign Het
Or6c208 A T 10: 129,223,652 (GRCm39) D50V probably damaging Het
Or7e177 T C 9: 20,212,134 (GRCm39) Y214H probably benign Het
Pafah2 T A 4: 134,131,468 (GRCm39) I52N probably damaging Het
Pcsk6 A T 7: 65,693,283 (GRCm39) I693F possibly damaging Het
Pde4c G T 8: 71,199,262 (GRCm39) R228L probably benign Het
Pdzd8 T C 19: 59,288,904 (GRCm39) N832S probably benign Het
Plbd1 T A 6: 136,590,814 (GRCm39) M451L probably benign Het
Pramel14 G T 4: 143,719,851 (GRCm39) D171E probably benign Het
Prom1 T C 5: 44,194,965 (GRCm39) D260G probably damaging Het
Ranbp17 A G 11: 33,216,310 (GRCm39) S813P probably damaging Het
Scn10a T C 9: 119,520,544 (GRCm39) I119V probably benign Het
Sh3pxd2b A G 11: 32,365,967 (GRCm39) T353A probably damaging Het
Shq1 A T 6: 100,646,659 (GRCm39) probably null Het
Slc22a28 T A 19: 8,049,223 (GRCm39) H342L possibly damaging Het
Slco2b1 C T 7: 99,314,114 (GRCm39) E9K probably null Het
Specc1l T C 10: 75,082,118 (GRCm39) F505L probably damaging Het
Sptan1 G T 2: 29,870,215 (GRCm39) probably null Het
St6gal2 A G 17: 55,797,932 (GRCm39) probably benign Het
Taok2 T C 7: 126,479,313 (GRCm39) I73V probably benign Het
Tax1bp1 C T 6: 52,721,229 (GRCm39) T478I probably benign Het
Tbc1d4 A T 14: 101,744,542 (GRCm39) N361K probably damaging Het
Tph1 A T 7: 46,296,907 (GRCm39) Y429* probably null Het
Tprkb A T 6: 85,901,403 (GRCm39) R14W probably damaging Het
Trio A T 15: 27,753,890 (GRCm39) probably benign Het
Ttc23 T C 7: 67,316,902 (GRCm39) probably benign Het
Vmn1r211 T C 13: 23,036,415 (GRCm39) Y84C probably damaging Het
Vmn2r22 C G 6: 123,614,624 (GRCm39) G322A possibly damaging Het
Wdr74 A G 19: 8,717,776 (GRCm39) Q330R probably benign Het
Wdtc1 C A 4: 133,024,739 (GRCm39) S486I possibly damaging Het
Zbtb24 T C 10: 41,340,989 (GRCm39) V673A possibly damaging Het
Zfpm2 A T 15: 40,965,877 (GRCm39) R655S probably damaging Het
Zkscan5 A G 5: 145,157,798 (GRCm39) N694D probably benign Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152,382,629 (GRCm39) missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152,384,481 (GRCm39) missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152,348,859 (GRCm39) missense probably damaging 1.00
R0409:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0412:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152,360,622 (GRCm39) missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0519:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0556:Colgalt2 UTSW 1 152,347,564 (GRCm39) splice site probably benign
R0605:Colgalt2 UTSW 1 152,371,543 (GRCm39) splice site probably benign
R0628:Colgalt2 UTSW 1 152,384,312 (GRCm39) missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152,347,495 (GRCm39) missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152,378,768 (GRCm39) missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152,348,912 (GRCm39) missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152,379,904 (GRCm39) missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152,360,703 (GRCm39) missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152,276,114 (GRCm39) missense probably damaging 1.00
R2285:Colgalt2 UTSW 1 152,344,301 (GRCm39) missense probably benign 0.00
R2917:Colgalt2 UTSW 1 152,347,495 (GRCm39) missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152,384,362 (GRCm39) nonsense probably null
R3917:Colgalt2 UTSW 1 152,384,362 (GRCm39) nonsense probably null
R4250:Colgalt2 UTSW 1 152,365,638 (GRCm39) missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152,344,282 (GRCm39) missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152,360,763 (GRCm39) missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152,382,627 (GRCm39) missense probably damaging 1.00
R4743:Colgalt2 UTSW 1 152,276,094 (GRCm39) missense probably damaging 0.97
R4751:Colgalt2 UTSW 1 152,365,627 (GRCm39) missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152,360,749 (GRCm39) missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152,375,710 (GRCm39) missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152,360,620 (GRCm39) missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152,276,054 (GRCm39) missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152,379,873 (GRCm39) missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152,348,912 (GRCm39) missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152,347,549 (GRCm39) missense probably damaging 1.00
R6837:Colgalt2 UTSW 1 152,382,579 (GRCm39) missense probably damaging 1.00
R7464:Colgalt2 UTSW 1 152,379,895 (GRCm39) missense probably damaging 0.97
R8462:Colgalt2 UTSW 1 152,378,823 (GRCm39) missense probably damaging 1.00
R8725:Colgalt2 UTSW 1 152,360,662 (GRCm39) missense probably damaging 0.99
R8727:Colgalt2 UTSW 1 152,360,662 (GRCm39) missense probably damaging 0.99
R9118:Colgalt2 UTSW 1 152,378,906 (GRCm39) intron probably benign
R9186:Colgalt2 UTSW 1 152,384,403 (GRCm39) missense probably damaging 0.98
R9393:Colgalt2 UTSW 1 152,360,598 (GRCm39) nonsense probably null
R9611:Colgalt2 UTSW 1 152,360,745 (GRCm39) missense probably damaging 1.00
X0028:Colgalt2 UTSW 1 152,347,471 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATATCCATACTTGCCTGCTCG -3'
(R):5'- CAGCATAGACAGTACCTGCTTGCC -3'

Sequencing Primer
(F):5'- AATGGTTCCCGCTATTAGAACCC -3'
(R):5'- GCTTGCCTGCTGGAGAAG -3'
Posted On 2014-03-14