Incidental Mutation 'R9186:Colgalt2'
ID 697353
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Name collagen beta(1-O)galactosyltransferase 2
Synonyms Glt25d2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R9186 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 152399830-152510695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 152508652 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 581 (T581K)
Ref Sequence ENSEMBL: ENSMUSP00000037532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
AlphaFold Q6NVG7
Predicted Effect probably damaging
Transcript: ENSMUST00000044311
AA Change: T581K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: T581K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127586
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,257,189 R634L probably damaging Het
Ankhd1 T C 18: 36,634,330 I210T possibly damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Arid3b A T 9: 57,794,934 probably null Het
Arl10 A G 13: 54,578,807 N133D probably damaging Het
Bag6 C T 17: 35,144,691 R784W probably damaging Het
Ccnl1 T C 3: 65,958,005 T42A unknown Het
Cd164 C A 10: 41,528,699 P151Q probably damaging Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Ceacam2 T A 7: 25,527,788 N218I probably damaging Het
Cfap97 C T 8: 46,191,628 R466C possibly damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dusp13 A T 14: 21,748,495 S34T probably damaging Het
Esf1 T A 2: 140,148,872 K564I possibly damaging Het
F5 A G 1: 164,193,901 N1315S probably benign Het
Fubp1 A T 3: 152,220,516 M292L probably damaging Het
Gabrb2 A T 11: 42,487,373 M139L possibly damaging Het
Gk5 T A 9: 96,133,416 V95D probably benign Het
Glcci1 C A 6: 8,537,826 P148Q possibly damaging Het
Gm19410 A T 8: 35,815,475 S1952C possibly damaging Het
Gstm4 T C 3: 108,044,733 probably benign Het
Heatr1 T A 13: 12,421,346 L1211Q probably damaging Het
Helz2 A G 2: 181,234,664 S1346P possibly damaging Het
Hexb A C 13: 97,189,328 V158G probably damaging Het
Hipk3 T C 2: 104,471,094 E251G probably damaging Het
Hps5 T C 7: 46,788,946 Y89C probably damaging Het
Iqub A T 6: 24,450,767 V611D possibly damaging Het
Itgbl1 G A 14: 123,857,558 D332N probably benign Het
Krtap26-1 C A 16: 88,647,721 R4L unknown Het
Lgi3 A G 14: 70,534,753 Y246C probably damaging Het
Mug2 T A 6: 122,075,289 I1002N probably damaging Het
Myo18a C T 11: 77,859,021 T66M Het
Naip6 T C 13: 100,299,882 D711G possibly damaging Het
Olfr1312 C A 2: 112,042,750 C94F probably damaging Het
Orc5 T A 5: 22,547,946 Q48L probably benign Het
Oxct2a C A 4: 123,322,668 A307S probably damaging Het
Pgls T C 8: 71,596,189 *258Q probably null Het
Plekha6 C T 1: 133,292,433 R955W probably damaging Het
Polr1c G T 17: 46,245,707 N97K probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prtg T C 9: 72,856,877 V544A probably benign Het
Rbl2 G A 8: 91,101,378 G574S probably damaging Het
Scamp1 T A 13: 94,208,174 T272S possibly damaging Het
Sun2 T A 15: 79,727,536 D562V probably damaging Het
Szt2 A G 4: 118,385,091 F1565S probably damaging Het
Tatdn2 C T 6: 113,710,164 R779C probably benign Het
Tbc1d30 T C 10: 121,275,734 I430V probably benign Het
Tmem86b T C 7: 4,629,726 D43G probably damaging Het
Tnrc18 T C 5: 142,787,733 N447S Het
Trmt2a T C 16: 18,251,169 S292P probably benign Het
Trpc2 T C 7: 102,088,285 V428A probably damaging Het
Tsc2 T C 17: 24,604,888 E981G probably damaging Het
Ucp1 G T 8: 83,290,643 G21* probably null Het
Utrn T C 10: 12,614,574 T21A probably benign Het
Vapa A T 17: 65,593,512 N88K probably damaging Het
Wasl T C 6: 24,664,616 R10G probably damaging Het
Zan C A 5: 137,393,548 V4662F unknown Het
Zap70 G A 1: 36,779,751 M382I possibly damaging Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152506878 missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152508730 missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152473108 missense probably damaging 1.00
R0409:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0412:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152484871 missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0519:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0556:Colgalt2 UTSW 1 152471813 splice site probably benign
R0605:Colgalt2 UTSW 1 152495792 splice site probably benign
R0628:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152503017 missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152504153 missense probably damaging 1.00
R1456:Colgalt2 UTSW 1 152484904 missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152484952 missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152400363 missense probably damaging 1.00
R2285:Colgalt2 UTSW 1 152468550 missense probably benign 0.00
R2917:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152508611 nonsense probably null
R3917:Colgalt2 UTSW 1 152508611 nonsense probably null
R4250:Colgalt2 UTSW 1 152489887 missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152468531 missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152485012 missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152506876 missense probably damaging 1.00
R4743:Colgalt2 UTSW 1 152400343 missense probably damaging 0.97
R4751:Colgalt2 UTSW 1 152489876 missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152484998 missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152499959 missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152484869 missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152400303 missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152504122 missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152471798 missense probably damaging 1.00
R6837:Colgalt2 UTSW 1 152506828 missense probably damaging 1.00
R7464:Colgalt2 UTSW 1 152504144 missense probably damaging 0.97
R8462:Colgalt2 UTSW 1 152503072 missense probably damaging 1.00
R8725:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
R8727:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
R9118:Colgalt2 UTSW 1 152503155 intron probably benign
R9393:Colgalt2 UTSW 1 152484847 nonsense probably null
R9611:Colgalt2 UTSW 1 152484994 missense probably damaging 1.00
X0028:Colgalt2 UTSW 1 152471720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACAAGCAGGGCTCTCTG -3'
(R):5'- AGACAGTGATGAACCTTGCAGAC -3'

Sequencing Primer
(F):5'- GCCTTCCCCATTCCCTGAGAC -3'
(R):5'- GTGATGAACCTTGCAGACCACAC -3'
Posted On 2022-02-07