Incidental Mutation 'R1490:Tmem116'
ID163644
Institutional Source Beutler Lab
Gene Symbol Tmem116
Ensembl Gene ENSMUSG00000029452
Gene Nametransmembrane protein 116
Synonyms
MMRRC Submission 039542-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1490 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121451893-121524183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121495111 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 183 (S183P)
Ref Sequence ENSEMBL: ENSMUSP00000054232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031405] [ENSMUST00000060004] [ENSMUST00000079368] [ENSMUST00000094357] [ENSMUST00000111795] [ENSMUST00000149966] [ENSMUST00000156080]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031405
AA Change: S303P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031405
Gene: ENSMUSG00000029452
AA Change: S303P

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 65 84 N/A INTRINSIC
transmembrane domain 105 127 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 225 242 N/A INTRINSIC
transmembrane domain 257 279 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060004
AA Change: S183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054232
Gene: ENSMUSG00000029452
AA Change: S183P

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 105 122 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079368
SMART Domains Protein: ENSMUSP00000078343
Gene: ENSMUSG00000062438

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 159 1.6e-18 PFAM
Pfam:Reprolysin_5 201 378 2.9e-15 PFAM
Pfam:Reprolysin_4 202 386 6.8e-9 PFAM
Pfam:Reprolysin 203 397 2.4e-70 PFAM
Pfam:Reprolysin_3 223 349 3.9e-14 PFAM
Pfam:Reprolysin_2 223 387 5.8e-9 PFAM
DISIN 415 488 8.08e-29 SMART
ACR 489 628 3.41e-47 SMART
EGF 634 665 2.34e1 SMART
transmembrane domain 705 727 N/A INTRINSIC
coiled coil region 763 801 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094357
AA Change: S338P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091917
Gene: ENSMUSG00000029452
AA Change: S338P

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 260 277 N/A INTRINSIC
transmembrane domain 292 314 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111795
SMART Domains Protein: ENSMUSP00000144614
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124247
SMART Domains Protein: ENSMUSP00000134334
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149966
SMART Domains Protein: ENSMUSP00000116328
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 105 123 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150805
AA Change: S374P
Predicted Effect probably benign
Transcript: ENSMUST00000156080
SMART Domains Protein: ENSMUSP00000121579
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik A G 19: 11,141,538 I69T probably benign Het
Aldh1l2 G A 10: 83,520,370 T52I probably damaging Het
Arhgef28 G A 13: 97,978,444 R633W probably damaging Het
Atg9a T C 1: 75,185,745 N507S possibly damaging Het
Bsn A G 9: 108,113,994 S1520P probably benign Het
Cacul1 G T 19: 60,580,399 A107E probably damaging Het
Cd74 A G 18: 60,811,366 D216G probably damaging Het
Cdh16 A T 8: 104,622,070 W109R probably damaging Het
Cdip1 C T 16: 4,768,911 V100I probably damaging Het
Ceacam3 A G 7: 17,163,146 D679G probably damaging Het
Comp A G 8: 70,373,913 D46G possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmrta2 T C 4: 109,979,875 S5P unknown Het
E130308A19Rik A G 4: 59,719,746 Y426C probably damaging Het
Entpd3 A G 9: 120,554,159 S87G probably benign Het
Eps8l1 A G 7: 4,470,889 R232G probably damaging Het
Gart A T 16: 91,624,344 V812D probably damaging Het
Gm10153 C T 7: 142,190,142 C83Y unknown Het
Gpd2 T C 2: 57,355,475 V394A probably damaging Het
Hpcal1 A T 12: 17,786,224 E18D probably benign Het
Mdga2 T C 12: 66,797,756 D156G probably benign Het
Mks1 A G 11: 87,862,769 K510E probably benign Het
Mtmr4 G A 11: 87,612,225 R1035Q probably damaging Het
Myh6 T A 14: 54,962,718 K235* probably null Het
Nedd1 A G 10: 92,700,798 F214S probably damaging Het
Olfr166 T C 16: 19,486,922 M28T probably benign Het
Olfr392 A G 11: 73,814,371 V237A possibly damaging Het
Olfr672 A G 7: 104,996,493 I137T possibly damaging Het
Olfr98 A G 17: 37,262,842 M274T probably benign Het
Pfkfb2 A C 1: 130,697,889 probably null Het
Pfkfb4 T C 9: 109,027,620 L398P probably damaging Het
Pfn3 T G 13: 55,414,919 D83A probably damaging Het
Pi4ka C A 16: 17,386,268 W54L probably damaging Het
Ppp3r1 A G 11: 17,198,275 D161G probably benign Het
Prrc2a A G 17: 35,153,254 S1757P probably benign Het
Samd7 A G 3: 30,758,353 E314G probably benign Het
Slc17a4 A G 13: 23,904,753 I217T probably benign Het
Slc22a1 A T 17: 12,662,893 probably null Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Sos1 A T 17: 80,413,675 H905Q probably benign Het
Thada G A 17: 84,446,601 T314I possibly damaging Het
Tirap ACTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTG 9: 35,189,066 probably benign Het
Tlr11 A C 14: 50,363,176 H873P probably benign Het
Tlr4 A T 4: 66,839,374 T135S possibly damaging Het
Tubgcp3 A T 8: 12,639,550 I572K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C T 1: 188,359,841 T523I probably benign Het
Usp40 G A 1: 87,988,965 Q364* probably null Het
Vmn1r61 T C 7: 5,611,243 Q24R probably benign Het
Wdfy4 C A 14: 33,152,538 probably null Het
Zfp458 G A 13: 67,257,509 P286S probably damaging Het
Zfp68 A T 5: 138,606,829 C373S probably benign Het
Zfp768 T A 7: 127,343,631 I442F probably damaging Het
Zfp990 A G 4: 145,537,283 R284G probably benign Het
Other mutations in Tmem116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Tmem116 APN 5 121463799 missense probably benign 0.05
IGL02711:Tmem116 APN 5 121487741 splice site probably benign
R0008:Tmem116 UTSW 5 121495096 missense probably damaging 1.00
R0131:Tmem116 UTSW 5 121493782 splice site probably benign
R1163:Tmem116 UTSW 5 121493756 missense probably damaging 1.00
R2019:Tmem116 UTSW 5 121489254 missense possibly damaging 0.85
R6007:Tmem116 UTSW 5 121517892 makesense probably null
R6215:Tmem116 UTSW 5 121491108 missense probably benign 0.02
R6216:Tmem116 UTSW 5 121491108 missense probably benign 0.02
R6221:Tmem116 UTSW 5 121491108 missense probably benign 0.02
R6222:Tmem116 UTSW 5 121491108 missense probably benign 0.02
R6980:Tmem116 UTSW 5 121467987 critical splice donor site probably null
R7055:Tmem116 UTSW 5 121467924 missense probably damaging 1.00
R7248:Tmem116 UTSW 5 121463836 splice site probably null
R7268:Tmem116 UTSW 5 121467855 missense
R7485:Tmem116 UTSW 5 121495061 missense
R7655:Tmem116 UTSW 5 121452189 critical splice donor site probably null
R7656:Tmem116 UTSW 5 121452189 critical splice donor site probably null
X0024:Tmem116 UTSW 5 121482394 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGCGCAATGCTAAGTCTGTATGAG -3'
(R):5'- AATTGCTACTGACCCTGAGCCCAC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GACCCTGAGCCCACATTTC -3'
Posted On2014-03-28