Mutagenetix > Incidental Mutations

Incidental Mutation 'R1490:Usp40'

163632

Institutional Source

Beutler Lab

Gene Symbol

Usp40

Ensembl Gene

ENSMUSG00000005501

Gene Name

ubiquitin specific peptidase 40

Synonyms

B230215L03Rik

MMRRC Submission

039542-MU

Accession Numbers

Genbank: NM_001033291

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1490 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87945119-88008551 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 87988965 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 364 (Q364*)

Ref Sequence

ENSEMBL: ENSMUSP00000140107 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040783] [ENSMUST00000187758] [ENSMUST00000188332]

Predicted Effect

probably null
Transcript: ENSMUST00000040783
AA Change: Q364*

SMART Domains

Protein: ENSMUSP00000038533
Gene: ENSMUSG00000005501
AA Change: Q364*

Domain	Start	End	E-Value	Type
Pfam:UCH	40	344	1.1e-31	PFAM
Pfam:UCH_1	41	320	1.2e-20	PFAM
low complexity region	641	650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186315

Predicted Effect

probably null
Transcript: ENSMUST00000187758
AA Change: Q364*

SMART Domains

Protein: ENSMUSP00000140107
Gene: ENSMUSG00000005501
AA Change: Q364*

Domain	Start	End	E-Value	Type
Pfam:UCH	40	346	8.7e-41	PFAM
Pfam:UCH_1	41	319	2.4e-22	PFAM
low complexity region	641	650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188332

SMART Domains

Protein: ENSMUSP00000140574
Gene: ENSMUSG00000005501

Domain	Start	End	E-Value	Type
Pfam:UCH	40	70	5.9e-6	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025F22Rik	A	G	19: 11,141,538	I69T	probably benign	Het
Aldh1l2	G	A	10: 83,520,370	T52I	probably damaging	Het
Arhgef28	G	A	13: 97,978,444	R633W	probably damaging	Het
Atg9a	T	C	1: 75,185,745	N507S	possibly damaging	Het
Bsn	A	G	9: 108,113,994	S1520P	probably benign	Het
Cacul1	G	T	19: 60,580,399	A107E	probably damaging	Het
Cd74	A	G	18: 60,811,366	D216G	probably damaging	Het
Cdh16	A	T	8: 104,622,070	W109R	probably damaging	Het
Cdip1	C	T	16: 4,768,911	V100I	probably damaging	Het
Ceacam3	A	G	7: 17,163,146	D679G	probably damaging	Het
Comp	A	G	8: 70,373,913	D46G	possibly damaging	Het
Dlx3	T	C	11: 95,120,604	Y95H	probably benign	Het
Dmrta2	T	C	4: 109,979,875	S5P	unknown	Het
E130308A19Rik	A	G	4: 59,719,746	Y426C	probably damaging	Het
Entpd3	A	G	9: 120,554,159	S87G	probably benign	Het
Eps8l1	A	G	7: 4,470,889	R232G	probably damaging	Het
Gart	A	T	16: 91,624,344	V812D	probably damaging	Het
Gm10153	C	T	7: 142,190,142	C83Y	unknown	Het
Gpd2	T	C	2: 57,355,475	V394A	probably damaging	Het
Hpcal1	A	T	12: 17,786,224	E18D	probably benign	Het
Mdga2	T	C	12: 66,797,756	D156G	probably benign	Het
Mks1	A	G	11: 87,862,769	K510E	probably benign	Het
Mtmr4	G	A	11: 87,612,225	R1035Q	probably damaging	Het
Myh6	T	A	14: 54,962,718	K235*	probably null	Het
Nedd1	A	G	10: 92,700,798	F214S	probably damaging	Het
Olfr166	T	C	16: 19,486,922	M28T	probably benign	Het
Olfr392	A	G	11: 73,814,371	V237A	possibly damaging	Het
Olfr672	A	G	7: 104,996,493	I137T	possibly damaging	Het
Olfr98	A	G	17: 37,262,842	M274T	probably benign	Het
Pfkfb2	A	C	1: 130,697,889		probably null	Het
Pfkfb4	T	C	9: 109,027,620	L398P	probably damaging	Het
Pfn3	T	G	13: 55,414,919	D83A	probably damaging	Het
Pi4ka	C	A	16: 17,386,268	W54L	probably damaging	Het
Ppp3r1	A	G	11: 17,198,275	D161G	probably benign	Het
Prrc2a	A	G	17: 35,153,254	S1757P	probably benign	Het
Samd7	A	G	3: 30,758,353	E314G	probably benign	Het
Slc17a4	A	G	13: 23,904,753	I217T	probably benign	Het
Slc22a1	A	T	17: 12,662,893		probably null	Het
Slc7a7	C	T	14: 54,408,646	R120H	probably damaging	Het
Sos1	A	T	17: 80,413,675	H905Q	probably benign	Het
Thada	G	A	17: 84,446,601	T314I	possibly damaging	Het
Tirap	ACTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTG	9: 35,189,066		probably benign	Het
Tlr11	A	C	14: 50,363,176	H873P	probably benign	Het
Tlr4	A	T	4: 66,839,374	T135S	possibly damaging	Het
Tmem116	T	C	5: 121,495,111	S183P	probably damaging	Het
Tubgcp3	A	T	8: 12,639,550	I572K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	C	T	1: 188,359,841	T523I	probably benign	Het
Vmn1r61	T	C	7: 5,611,243	Q24R	probably benign	Het
Wdfy4	C	A	14: 33,152,538		probably null	Het
Zfp458	G	A	13: 67,257,509	P286S	probably damaging	Het
Zfp68	A	T	5: 138,606,829	C373S	probably benign	Het
Zfp768	T	A	7: 127,343,631	I442F	probably damaging	Het
Zfp990	A	G	4: 145,537,283	R284G	probably benign	Het

Other mutations in Usp40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Usp40	APN	1	88004238	splice site	probably benign
IGL00828:Usp40	APN	1	87978306	unclassified	probably benign
IGL01090:Usp40	APN	1	87962465	missense	probably benign	0.01
IGL01123:Usp40	APN	1	87986123	missense	probably benign	0.01
IGL01401:Usp40	APN	1	87994198	missense	probably damaging	1.00
IGL02506:Usp40	APN	1	87982016	missense	probably damaging	0.98
IGL02580:Usp40	APN	1	87980966	splice site	probably null
IGL02625:Usp40	APN	1	87950017	missense	probably benign	0.19
IGL02811:Usp40	APN	1	87995736	missense	probably damaging	1.00
IGL02958:Usp40	APN	1	87978485	missense	probably damaging	0.99
G5030:Usp40	UTSW	1	87994219	missense	probably damaging	1.00
R0019:Usp40	UTSW	1	87978411	missense	probably benign	0.00
R0282:Usp40	UTSW	1	87980958	splice site	probably benign
R0453:Usp40	UTSW	1	87946598	makesense	probably null
R0646:Usp40	UTSW	1	87978522	missense	probably benign	0.00
R1440:Usp40	UTSW	1	87982086	missense	probably benign	0.01
R1620:Usp40	UTSW	1	87994225	missense	probably damaging	1.00
R1881:Usp40	UTSW	1	87994271	missense	probably benign	0.08
R1903:Usp40	UTSW	1	87982056	missense	probably benign	0.15
R1912:Usp40	UTSW	1	87946646	missense	probably benign	0.00
R1919:Usp40	UTSW	1	87995842	missense	possibly damaging	0.75
R1976:Usp40	UTSW	1	87978536	missense	probably benign	0.00
R2111:Usp40	UTSW	1	87950214	missense	probably benign	0.17
R2112:Usp40	UTSW	1	87950214	missense	probably benign	0.17
R2163:Usp40	UTSW	1	87995858	splice site	probably benign
R2432:Usp40	UTSW	1	87982082	missense	probably benign
R2865:Usp40	UTSW	1	87949979	nonsense	probably null
R3885:Usp40	UTSW	1	87967269	missense	probably damaging	1.00
R4360:Usp40	UTSW	1	87952361	missense	probably damaging	1.00
R4370:Usp40	UTSW	1	87997875	missense	probably benign
R4496:Usp40	UTSW	1	87995737	missense	possibly damaging	0.69
R4714:Usp40	UTSW	1	87967179	splice site	probably null
R4888:Usp40	UTSW	1	87986201	critical splice acceptor site	probably null
R4944:Usp40	UTSW	1	87952355	missense	probably benign	0.10
R5269:Usp40	UTSW	1	87995782	missense	probably benign	0.01
R5629:Usp40	UTSW	1	87981009	missense	probably benign
R5696:Usp40	UTSW	1	87995752	missense	probably benign	0.27
R5756:Usp40	UTSW	1	87951691	missense	possibly damaging	0.66
R5887:Usp40	UTSW	1	87999870	missense	probably damaging	1.00
R5910:Usp40	UTSW	1	87968400	nonsense	probably null
R6014:Usp40	UTSW	1	87980016	missense	probably damaging	1.00
R6044:Usp40	UTSW	1	87990150	missense	probably benign
R6083:Usp40	UTSW	1	87978559	missense	probably benign	0.01
R6299:Usp40	UTSW	1	87997927	missense	probably damaging	0.99
R6625:Usp40	UTSW	1	87967213	missense	probably benign	0.01
R6757:Usp40	UTSW	1	87980037	missense	probably damaging	0.99
R6810:Usp40	UTSW	1	87981033	missense	probably benign	0.11
R7110:Usp40	UTSW	1	87986162	missense	probably benign	0.11
R7573:Usp40	UTSW	1	87986072	missense	probably benign	0.09
R7575:Usp40	UTSW	1	87949960	missense	probably damaging	1.00
R7634:Usp40	UTSW	1	87962430	nonsense	probably null
R7756:Usp40	UTSW	1	87967200	missense	probably damaging	0.99
R7767:Usp40	UTSW	1	87982178	missense	probably benign	0.01
R7861:Usp40	UTSW	1	87982130	missense	probably damaging	0.99
R7881:Usp40	UTSW	1	87995713	nonsense	probably null
R7896:Usp40	UTSW	1	87978479	missense	possibly damaging	0.77
R7944:Usp40	UTSW	1	87982130	missense	probably damaging	0.99
R7964:Usp40	UTSW	1	87995713	nonsense	probably null
R7979:Usp40	UTSW	1	87978479	missense	possibly damaging	0.77
RF006:Usp40	UTSW	1	87967195	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- CCTACTACACAGGAACTCGTGTTGC -3'
(R):5'- ACAACCTTAGGACTCCCTCTGGATG -3'

Sequencing Primer
(F):5'- AACTCGTGTTGCTGGGATTG -3'
(R):5'- GGTCTTATAAACCAGTGCTCAAGG -3'

Posted On

2014-03-28