Incidental Mutation 'R1513:Vmn1r45'
ID 168514
Institutional Source Beutler Lab
Gene Symbol Vmn1r45
Ensembl Gene ENSMUSG00000044248
Gene Name vomeronasal 1 receptor 45
Synonyms V1ra2, V1r2
MMRRC Submission 039560-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R1513 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 89908632-89917489 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89910058 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 304 (V304A)
Ref Sequence ENSEMBL: ENSMUSP00000154795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054202] [ENSMUST00000226167] [ENSMUST00000227122] [ENSMUST00000227426] [ENSMUST00000227571] [ENSMUST00000227977] [ENSMUST00000228662] [ENSMUST00000228492]
AlphaFold Q8VIC7
Predicted Effect probably damaging
Transcript: ENSMUST00000054202
AA Change: V304A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052123
Gene: ENSMUSG00000044248
AA Change: V304A

DomainStartEndE-ValueType
Pfam:TAS2R 26 315 2.5e-10 PFAM
Pfam:V1R 54 318 1.5e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226167
AA Change: V184A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000227122
AA Change: V184A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000227426
AA Change: V304A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227571
AA Change: V184A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000227977
AA Change: V304A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228662
AA Change: V304A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228492
AA Change: V184A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,947,334 (GRCm39) C64* probably null Het
1700003H04Rik A C 3: 124,368,985 (GRCm39) Y109D possibly damaging Het
Abca15 A T 7: 119,939,322 (GRCm39) I239F probably damaging Het
Adgrv1 A G 13: 81,741,167 (GRCm39) V99A probably damaging Het
Adgrv1 A T 13: 81,705,076 (GRCm39) I1578K probably damaging Het
Ap4e1 G T 2: 126,903,475 (GRCm39) K792N probably null Het
Ap5b1 G A 19: 5,619,892 (GRCm39) W437* probably null Het
Arhgef17 A G 7: 100,580,069 (GRCm39) L293P probably benign Het
Arhgef33 A C 17: 80,678,818 (GRCm39) M505L probably benign Het
Arih1 T A 9: 59,310,663 (GRCm39) R320S probably damaging Het
Atp1b3 A T 9: 96,246,206 (GRCm39) M1K probably null Het
Bbs2 T C 8: 94,816,472 (GRCm39) D130G possibly damaging Het
Bscl2 G A 19: 8,818,509 (GRCm39) R38H probably damaging Het
Cad A G 5: 31,226,106 (GRCm39) Y1102C probably damaging Het
Cc2d1b G A 4: 108,490,423 (GRCm39) R825Q probably damaging Het
Ccdc39 A G 3: 33,893,294 (GRCm39) V97A possibly damaging Het
Ccr1 T C 9: 123,764,510 (GRCm39) T7A probably benign Het
Cd33 A G 7: 43,181,618 (GRCm39) S181P probably damaging Het
Cdc20 A C 4: 118,290,304 (GRCm39) S452R probably damaging Het
Cdk8 A T 5: 146,233,188 (GRCm39) I229F possibly damaging Het
Ces3a A T 8: 105,776,909 (GRCm39) N131Y probably damaging Het
Cgnl1 A G 9: 71,631,872 (GRCm39) I493T probably benign Het
Chia1 G A 3: 106,039,220 (GRCm39) V437M probably benign Het
Chrna2 G A 14: 66,380,878 (GRCm39) R49H probably benign Het
Clec12b A G 6: 129,353,265 (GRCm39) C241R probably damaging Het
Col11a1 A G 3: 113,890,803 (GRCm39) D380G unknown Het
Crebbp A G 16: 3,933,749 (GRCm39) S948P probably damaging Het
Dchs1 G A 7: 105,421,278 (GRCm39) R381* probably null Het
Defb19 A T 2: 152,418,085 (GRCm39) *84R probably null Het
Dnah8 T C 17: 30,892,862 (GRCm39) F816L probably benign Het
Dync2h1 T A 9: 7,103,663 (GRCm39) I371F possibly damaging Het
Ezhip GTCATCATCATCATC GTCATCATCATCATCATC X: 5,994,645 (GRCm39) probably benign Het
Fggy T C 4: 95,790,295 (GRCm39) probably benign Het
Galnt12 G A 4: 47,117,956 (GRCm39) C125Y probably damaging Het
Gm4952 A T 19: 12,602,039 (GRCm39) D149V probably damaging Het
Gm6309 A T 5: 146,107,393 (GRCm39) H37Q possibly damaging Het
Gmnn A G 13: 24,940,615 (GRCm39) L78P possibly damaging Het
Golga4 C A 9: 118,384,800 (GRCm39) Q613K probably benign Het
Iqgap2 A T 13: 95,766,518 (GRCm39) I1495K probably damaging Het
Junb T C 8: 85,704,758 (GRCm39) T101A probably damaging Het
Kif21b T C 1: 136,083,849 (GRCm39) Y699H probably damaging Het
Klf17 T C 4: 117,618,132 (GRCm39) E75G probably damaging Het
Klra17 T C 6: 129,849,277 (GRCm39) E99G possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 7: 118,451,672 (GRCm39) probably benign Het
Krt87 C T 15: 101,387,538 (GRCm39) V167M probably benign Het
Lce1m A G 3: 92,925,932 (GRCm39) probably benign Het
Lpin3 A T 2: 160,746,468 (GRCm39) Y709F probably damaging Het
Ltbp2 T A 12: 84,838,718 (GRCm39) D1080V probably damaging Het
Mycbp2 G A 14: 103,441,825 (GRCm39) T1980I probably damaging Het
Myo1g T A 11: 6,465,140 (GRCm39) K435M probably damaging Het
Mypn T A 10: 63,005,147 (GRCm39) N320I probably damaging Het
Naip5 A T 13: 100,358,714 (GRCm39) W841R probably benign Het
Ncapd2 A T 6: 125,147,955 (GRCm39) M1124K probably damaging Het
Ncf4 A G 15: 78,146,560 (GRCm39) D330G probably benign Het
Ndst3 C T 3: 123,395,104 (GRCm39) V509M possibly damaging Het
Neb A T 2: 52,117,256 (GRCm39) D4105E probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nsrp1 A T 11: 76,937,445 (GRCm39) F250L probably benign Het
Or11g7 A G 14: 50,691,138 (GRCm39) I210V probably benign Het
Or4l15 T C 14: 50,198,558 (GRCm39) probably null Het
Or52d1 C T 7: 103,755,671 (GRCm39) L62F probably benign Het
Or52k2 G T 7: 102,254,509 (GRCm39) G316V probably benign Het
Or5m12 A T 2: 85,735,015 (GRCm39) Y128N probably damaging Het
Or8k3b C T 2: 86,521,141 (GRCm39) M59I possibly damaging Het
Oxr1 A G 15: 41,660,870 (GRCm39) D67G probably damaging Het
P2ry12 A T 3: 59,125,498 (GRCm39) I59N probably damaging Het
Pcdhb12 G T 18: 37,570,111 (GRCm39) G419V probably damaging Het
Pdzd2 G T 15: 12,373,915 (GRCm39) S2073R possibly damaging Het
Pex5l C A 3: 33,069,162 (GRCm39) E112* probably null Het
Plaur A G 7: 24,172,016 (GRCm39) D163G probably benign Het
Plk2 A G 13: 110,536,622 (GRCm39) Y638C probably benign Het
Ppp1r15b A G 1: 133,061,088 (GRCm39) N535S probably benign Het
Ppp2r1b T C 9: 50,781,445 (GRCm39) L21P probably damaging Het
Prkar2a G A 9: 108,605,469 (GRCm39) V176I possibly damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rag1 A G 2: 101,473,336 (GRCm39) M602T possibly damaging Het
Rb1 A G 14: 73,559,524 (GRCm39) V60A probably benign Het
Rgs20 T A 1: 4,982,560 (GRCm39) I303F probably damaging Het
Rnf43 T A 11: 87,620,257 (GRCm39) I240N probably damaging Het
Romo1 G A 2: 155,986,433 (GRCm39) V19M probably benign Het
Ryr1 A G 7: 28,770,046 (GRCm39) S2676P probably damaging Het
Ryr3 G A 2: 112,539,542 (GRCm39) Q3233* probably null Het
Skic2 G T 17: 35,066,420 (GRCm39) P188T probably damaging Het
Slc26a6 A G 9: 108,733,035 (GRCm39) R5G probably benign Het
Slc33a1 A G 3: 63,871,376 (GRCm39) L79P probably damaging Het
Snx31 G A 15: 36,545,745 (GRCm39) R91C probably damaging Het
Tecpr2 T C 12: 110,921,234 (GRCm39) I1269T possibly damaging Het
Tjap1 G T 17: 46,572,368 (GRCm39) D89E probably benign Het
Tmem53 A T 4: 117,123,090 (GRCm39) Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 (GRCm39) V95F possibly damaging Het
Trim30c A C 7: 104,031,896 (GRCm39) H306Q probably benign Het
Trpm3 A T 19: 22,964,236 (GRCm39) M1244L possibly damaging Het
Tspan32 A G 7: 142,558,886 (GRCm39) I14V probably null Het
Ube4b A G 4: 149,436,035 (GRCm39) V695A probably benign Het
Ubxn11 G A 4: 133,851,452 (GRCm39) probably null Het
Ugt3a1 A G 15: 9,361,610 (GRCm39) I129V probably benign Het
Vmn2r124 A T 17: 18,283,535 (GRCm39) S410C probably damaging Het
Vmn2r15 T A 5: 109,441,195 (GRCm39) D221V probably damaging Het
Vmn2r79 G A 7: 86,686,652 (GRCm39) V678I probably benign Het
Vps13b A T 15: 35,438,876 (GRCm39) R319* probably null Het
Wdr95 G A 5: 149,522,759 (GRCm39) R639Q probably benign Het
Xirp2 A G 2: 67,341,874 (GRCm39) I1372V probably benign Het
Xpo5 T A 17: 46,537,906 (GRCm39) M611K probably benign Het
Zfat A G 15: 68,084,529 (GRCm39) C121R probably damaging Het
Zfp382 A T 7: 29,832,721 (GRCm39) Y124F probably benign Het
Zfp512b A G 2: 181,230,982 (GRCm39) F371S probably benign Het
Zfy2 A G Y: 2,116,185 (GRCm39) V285A probably benign Het
Other mutations in Vmn1r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Vmn1r45 APN 6 89,910,646 (GRCm39) missense probably damaging 1.00
IGL02010:Vmn1r45 APN 6 89,910,668 (GRCm39) missense probably damaging 1.00
IGL02124:Vmn1r45 APN 6 89,910,035 (GRCm39) missense probably benign 0.03
IGL02413:Vmn1r45 APN 6 89,910,503 (GRCm39) missense possibly damaging 0.75
R0123:Vmn1r45 UTSW 6 89,910,492 (GRCm39) nonsense probably null
R0225:Vmn1r45 UTSW 6 89,910,492 (GRCm39) nonsense probably null
R2154:Vmn1r45 UTSW 6 89,910,965 (GRCm39) missense possibly damaging 0.91
R3082:Vmn1r45 UTSW 6 89,910,724 (GRCm39) missense probably benign 0.03
R3781:Vmn1r45 UTSW 6 89,910,799 (GRCm39) missense probably benign
R4982:Vmn1r45 UTSW 6 89,910,847 (GRCm39) missense probably damaging 0.99
R5086:Vmn1r45 UTSW 6 89,910,082 (GRCm39) missense probably benign 0.06
R5327:Vmn1r45 UTSW 6 89,910,123 (GRCm39) missense possibly damaging 0.79
R5470:Vmn1r45 UTSW 6 89,910,698 (GRCm39) missense probably benign 0.04
R6681:Vmn1r45 UTSW 6 89,910,985 (GRCm39) start gained probably benign
R7046:Vmn1r45 UTSW 6 89,910,538 (GRCm39) missense probably benign 0.00
R7050:Vmn1r45 UTSW 6 89,910,703 (GRCm39) missense probably damaging 0.97
R7171:Vmn1r45 UTSW 6 89,910,316 (GRCm39) missense probably damaging 1.00
R7236:Vmn1r45 UTSW 6 89,910,133 (GRCm39) missense probably benign 0.15
R7401:Vmn1r45 UTSW 6 89,910,416 (GRCm39) missense possibly damaging 0.64
R7417:Vmn1r45 UTSW 6 89,910,035 (GRCm39) missense probably benign 0.03
R8068:Vmn1r45 UTSW 6 89,910,261 (GRCm39) missense possibly damaging 0.53
R8223:Vmn1r45 UTSW 6 89,910,074 (GRCm39) missense probably damaging 0.99
R8942:Vmn1r45 UTSW 6 89,910,876 (GRCm39) missense probably benign 0.00
RF019:Vmn1r45 UTSW 6 89,910,091 (GRCm39) missense probably damaging 0.99
X0026:Vmn1r45 UTSW 6 89,910,724 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGGGGCAAAGCACATATACAGC -3'
(R):5'- ACCCTTGAGTTACGTCATGCAAAGC -3'

Sequencing Primer
(F):5'- TTGACAGTTCTGATGCCAGG -3'
(R):5'- AGCATGTATTCTACACTGCTGG -3'
Posted On 2014-04-13