Incidental Mutation 'R6681:Vmn1r45'
ID527496
Institutional Source Beutler Lab
Gene Symbol Vmn1r45
Ensembl Gene ENSMUSG00000044248
Gene Namevomeronasal 1 receptor 45
SynonymsV1r2, V1ra2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6681 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location89931649-89940598 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 89934003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054202] [ENSMUST00000226167] [ENSMUST00000227122] [ENSMUST00000227426] [ENSMUST00000227571] [ENSMUST00000227977] [ENSMUST00000228492] [ENSMUST00000228662]
Predicted Effect probably benign
Transcript: ENSMUST00000054202
SMART Domains Protein: ENSMUSP00000052123
Gene: ENSMUSG00000044248

DomainStartEndE-ValueType
Pfam:TAS2R 26 315 2.5e-10 PFAM
Pfam:V1R 54 318 1.5e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226167
Predicted Effect probably benign
Transcript: ENSMUST00000227122
Predicted Effect probably benign
Transcript: ENSMUST00000227426
Predicted Effect probably benign
Transcript: ENSMUST00000227571
Predicted Effect probably benign
Transcript: ENSMUST00000227977
Predicted Effect probably benign
Transcript: ENSMUST00000228492
Predicted Effect probably benign
Transcript: ENSMUST00000228662
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A T 3: 122,121,798 T971S probably damaging Het
Catsperb C T 12: 101,624,735 Q1021* probably null Het
Ccdc62 A G 5: 123,934,093 T62A probably benign Het
Cuzd1 A G 7: 131,311,683 S402P probably damaging Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Dennd2c A G 3: 103,131,661 T42A probably benign Het
Dnah7a T C 1: 53,521,226 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpp4 A T 2: 62,348,549 F607L probably benign Het
Ech1 C T 7: 28,830,338 probably null Het
Fam53a A G 5: 33,607,840 L174P probably damaging Het
Fh1 T C 1: 175,619,124 D62G probably null Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gpatch11 T C 17: 78,840,099 I103T probably damaging Het
Hmgcll1 A T 9: 76,081,449 T169S probably benign Het
Kbtbd3 A T 9: 4,330,687 I354F probably benign Het
Kdm5b T C 1: 134,613,269 F700L possibly damaging Het
Mamdc4 C A 2: 25,567,744 G439V probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Mug1 C T 6: 121,838,724 S29L possibly damaging Het
Myh2 G A 11: 67,178,348 D328N probably damaging Het
Olfr1106 T C 2: 87,048,598 T213A probably benign Het
Olfr1404 C A 1: 173,216,406 H252N probably damaging Het
Olfr1450 A G 19: 12,954,459 Y290C probably damaging Het
Olfr969 T A 9: 39,795,414 I13N probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Rest A G 5: 77,280,997 K421R probably damaging Het
Rttn C A 18: 89,014,611 H668N probably damaging Het
Scn9a T C 2: 66,563,342 I228V possibly damaging Het
Scp2 G T 4: 108,091,316 Q155K probably damaging Het
Sec61a2 G A 2: 5,876,408 R18* probably null Het
Serpinb8 T A 1: 107,597,591 M41K probably damaging Het
Sgsm2 A T 11: 74,865,378 W382R probably damaging Het
Slc26a10 G T 10: 127,173,661 T606N possibly damaging Het
Slc30a6 T C 17: 74,404,032 I40T possibly damaging Het
Slfn5 G A 11: 82,956,378 E30K possibly damaging Het
Sorcs2 C A 5: 36,397,810 R79L probably benign Het
Tmc5 G A 7: 118,669,304 S865N probably damaging Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Trpv5 C G 6: 41,653,354 E601Q probably damaging Het
Ttc39b A T 4: 83,240,048 probably benign Het
Ttll6 T A 11: 96,138,863 C201S probably damaging Het
Vezt A G 10: 93,996,997 V204A probably benign Het
Zfp433 A T 10: 81,720,888 H408L probably damaging Het
Zfp865 T C 7: 5,029,451 I145T possibly damaging Het
Other mutations in Vmn1r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Vmn1r45 APN 6 89933664 missense probably damaging 1.00
IGL02010:Vmn1r45 APN 6 89933686 missense probably damaging 1.00
IGL02124:Vmn1r45 APN 6 89933053 missense probably benign 0.03
IGL02413:Vmn1r45 APN 6 89933521 missense possibly damaging 0.75
R0123:Vmn1r45 UTSW 6 89933510 nonsense probably null
R0225:Vmn1r45 UTSW 6 89933510 nonsense probably null
R1513:Vmn1r45 UTSW 6 89933076 missense probably damaging 0.97
R2154:Vmn1r45 UTSW 6 89933983 missense possibly damaging 0.91
R3082:Vmn1r45 UTSW 6 89933742 missense probably benign 0.03
R3781:Vmn1r45 UTSW 6 89933817 missense probably benign
R4982:Vmn1r45 UTSW 6 89933865 missense probably damaging 0.99
R5086:Vmn1r45 UTSW 6 89933100 missense probably benign 0.06
R5327:Vmn1r45 UTSW 6 89933141 missense possibly damaging 0.79
R5470:Vmn1r45 UTSW 6 89933716 missense probably benign 0.04
R7046:Vmn1r45 UTSW 6 89933556 missense probably benign 0.00
R7050:Vmn1r45 UTSW 6 89933721 missense probably damaging 0.97
R7171:Vmn1r45 UTSW 6 89933334 missense probably damaging 1.00
R7236:Vmn1r45 UTSW 6 89933151 missense probably benign 0.15
R7401:Vmn1r45 UTSW 6 89933434 missense possibly damaging 0.64
R7417:Vmn1r45 UTSW 6 89933053 missense probably benign 0.03
R8068:Vmn1r45 UTSW 6 89933279 missense possibly damaging 0.53
R8223:Vmn1r45 UTSW 6 89933092 missense probably damaging 0.99
RF019:Vmn1r45 UTSW 6 89933109 missense probably damaging 0.99
X0026:Vmn1r45 UTSW 6 89933742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTGAGTCTGAGCCTGTG -3'
(R):5'- AGTAAGATGCTCCAGGAAAACC -3'

Sequencing Primer
(F):5'- CCTGTGTCCACGAATGAACTTTAGG -3'
(R):5'- GATGCTCCAGGAAAACCTACACATG -3'
Posted On2018-07-23