Incidental Mutation 'R6731:Stk32a'
ID530086
Institutional Source Beutler Lab
Gene Symbol Stk32a
Ensembl Gene ENSMUSG00000039954
Gene Nameserine/threonine kinase 32A
SynonymsYANK1, A930015B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6731 (G1)
Quality Score125.008
Status Validated
Chromosome18
Chromosomal Location43207697-43317481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43305078 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 214 (Y214C)
Ref Sequence ENSEMBL: ENSMUSP00000038471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045477]
Predicted Effect probably damaging
Transcript: ENSMUST00000045477
AA Change: Y214C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038471
Gene: ENSMUSG00000039954
AA Change: Y214C

DomainStartEndE-ValueType
S_TKc 23 281 9.58e-85 SMART
low complexity region 318 339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,066,226 V534A probably benign Het
Acta1 G A 8: 123,893,217 T128I probably damaging Het
Ahnak T A 19: 9,011,562 D3403E possibly damaging Het
Aldoc T A 11: 78,326,092 D319E probably benign Het
Ank3 T A 10: 70,014,028 D1108E possibly damaging Het
Ankrd7 G A 6: 18,866,654 G58S probably damaging Het
Ass1 A T 2: 31,514,784 Y359F probably damaging Het
B3gnt2 G T 11: 22,836,888 S100* probably null Het
Cd46 T C 1: 195,083,467 probably null Het
Chst5 G T 8: 111,890,044 R315S probably benign Het
Cps1 T C 1: 67,160,871 S393P probably damaging Het
Dis3l T C 9: 64,310,438 probably null Het
Fgg T C 3: 83,012,901 F329S probably damaging Het
Hsp90b1 T C 10: 86,701,905 T179A probably benign Het
Kat2a A T 11: 100,708,273 M559K probably damaging Het
Klhl41 T C 2: 69,674,700 I449T probably damaging Het
Lama5 A T 2: 180,188,574 I1880N probably benign Het
Lcp1 A G 14: 75,206,189 D215G probably damaging Het
Lrch3 A G 16: 32,950,420 T131A probably damaging Het
Mroh6 T C 15: 75,888,492 T78A probably benign Het
Naa15 T G 3: 51,455,873 V326G probably damaging Het
Nalcn T A 14: 123,599,934 Q6L probably benign Het
Nipbl T A 15: 8,322,590 I1863L probably damaging Het
Os9 C T 10: 127,098,543 G408D probably benign Het
Pcbp2 T C 15: 102,488,790 S237P probably damaging Het
Pcdhb10 G A 18: 37,413,476 R535H probably benign Het
Pex5l A T 3: 32,958,798 I320K probably damaging Het
Pgm1 T C 5: 64,100,975 F101S probably benign Het
Poc1b T A 10: 99,152,871 D207E probably null Het
Pou6f1 T C 15: 100,579,883 I460V possibly damaging Het
Rnf17 A T 14: 56,524,350 Q1623H possibly damaging Het
Rnf219 C T 14: 104,479,474 V488I probably benign Het
Rpap1 T C 2: 119,778,296 N195S probably benign Het
Sacs C A 14: 61,180,700 probably null Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Sele C T 1: 164,053,673 L481F probably damaging Het
Tex44 T A 1: 86,426,485 S39T probably benign Het
Tmem135 A T 7: 89,243,964 M140K possibly damaging Het
Tox2 A G 2: 163,320,377 Y354C probably damaging Het
Trim21 A T 7: 102,559,212 F433L probably damaging Het
Trim24 T C 6: 37,943,485 F406L probably damaging Het
Ubr1 G C 2: 120,955,640 H166Q probably null Het
Wnt16 T A 6: 22,297,892 Y252* probably null Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp141 T C 7: 42,489,500 D36G probably damaging Het
Zfp729a C T 13: 67,620,146 V655I probably benign Het
Zfp974 A T 7: 27,911,649 V217E possibly damaging Het
Other mutations in Stk32a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Stk32a APN 18 43310445 missense possibly damaging 0.46
IGL00704:Stk32a APN 18 43261249 missense probably damaging 1.00
IGL00813:Stk32a APN 18 43310520 missense probably benign 0.10
IGL02121:Stk32a APN 18 43313507 missense probably benign
IGL02407:Stk32a APN 18 43297511 missense probably benign 0.00
IGL02957:Stk32a APN 18 43311992 missense probably benign
R0004:Stk32a UTSW 18 43305056 missense probably damaging 1.00
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0288:Stk32a UTSW 18 43304995 splice site probably null
R0330:Stk32a UTSW 18 43313501 missense probably benign 0.15
R1337:Stk32a UTSW 18 43261349 missense probably benign 0.00
R1559:Stk32a UTSW 18 43243084 missense probably benign 0.32
R1695:Stk32a UTSW 18 43313420 nonsense probably null
R1874:Stk32a UTSW 18 43261316 missense probably damaging 1.00
R1954:Stk32a UTSW 18 43212025 missense probably benign 0.45
R4529:Stk32a UTSW 18 43242979 missense possibly damaging 0.83
R4980:Stk32a UTSW 18 43314048 missense probably benign 0.01
R5124:Stk32a UTSW 18 43305017 missense probably benign 0.00
R5751:Stk32a UTSW 18 43305020 missense possibly damaging 0.74
R5822:Stk32a UTSW 18 43313487 missense probably benign 0.00
R5863:Stk32a UTSW 18 43315144 missense probably benign 0.00
R6167:Stk32a UTSW 18 43313409 missense probably damaging 1.00
R6355:Stk32a UTSW 18 43297594 splice site probably null
R7162:Stk32a UTSW 18 43297584 nonsense probably null
R8001:Stk32a UTSW 18 43315144 missense possibly damaging 0.62
R8022:Stk32a UTSW 18 43315101 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGCTGCTAATTCTCCTTTGG -3'
(R):5'- CAATGCATTCCATTCTGAAAGGAAC -3'

Sequencing Primer
(F):5'- CCTTTGGAGAAAACGTGTTGG -3'
(R):5'- AAAACCCACTTGCTGTGCTGG -3'
Posted On2018-08-01