Incidental Mutation 'R1540:Caprin2'
ID171656
Institutional Source Beutler Lab
Gene Symbol Caprin2
Ensembl Gene ENSMUSG00000030309
Gene Namecaprin family member 2
SynonymsC1qdc1, Eeg1, RNG140
MMRRC Submission 039579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1540 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location148842492-148896237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148876471 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 211 (T211S)
Ref Sequence ENSEMBL: ENSMUSP00000107195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072324] [ENSMUST00000111569] [ENSMUST00000139914]
Predicted Effect probably benign
Transcript: ENSMUST00000072324
AA Change: T211S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072165
Gene: ENSMUSG00000030309
AA Change: T211S

DomainStartEndE-ValueType
coiled coil region 48 125 N/A INTRINSIC
coiled coil region 239 264 N/A INTRINSIC
Pfam:Caprin-1_C 317 618 1.2e-32 PFAM
C1Q 676 812 1.27e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111569
AA Change: T211S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107195
Gene: ENSMUSG00000030309
AA Change: T211S

DomainStartEndE-ValueType
coiled coil region 48 125 N/A INTRINSIC
coiled coil region 239 264 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:Caprin-1_C 536 836 2.9e-106 PFAM
C1Q 895 1031 1.27e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139914
SMART Domains Protein: ENSMUSP00000121685
Gene: ENSMUSG00000030309

DomainStartEndE-ValueType
coiled coil region 48 94 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: This gene encodes a member of the caprin family. The encoded protein may function as an RNA-binding protein that induces the formation of RNA granules and plays an important role in brain function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,780,735 C767R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap3d1 A T 10: 80,715,941 I644N probably benign Het
Asb16 A G 11: 102,272,576 I131V probably benign Het
Atp6v0a2 C A 5: 124,646,698 A307D probably damaging Het
C1qtnf1 C T 11: 118,447,923 H140Y probably benign Het
Cacna1g T A 11: 94,457,039 D741V probably damaging Het
Carmil1 T C 13: 24,099,054 E89G possibly damaging Het
Casz1 T A 4: 148,942,900 probably benign Het
Catsperb G A 12: 101,412,330 R30Q probably benign Het
Ccdc102a A T 8: 94,907,713 probably null Het
Ccdc110 G T 8: 45,942,325 E418* probably null Het
Ccdc90b C T 7: 92,581,816 A210V probably benign Het
Cdadc1 G T 14: 59,586,083 A320E probably damaging Het
Cdadc1 T A 14: 59,586,092 Q317L probably damaging Het
Cep170 C A 1: 176,739,932 W1396L probably damaging Het
Col4a6 T C X: 141,227,858 T129A probably damaging Het
Ctcfl C T 2: 173,112,348 D319N probably benign Het
Dclk1 T C 3: 55,477,823 S45P probably damaging Het
Efcab3 T C 11: 105,108,900 I5581T probably benign Het
Evi2 T C 11: 79,515,586 I388V probably benign Het
Fbxl5 A T 5: 43,758,636 V435E possibly damaging Het
Fig4 A T 10: 41,188,586 M887K possibly damaging Het
Glt8d1 G A 14: 31,011,592 V345I probably benign Het
Gm5709 T C 3: 59,618,652 noncoding transcript Het
Hsp90b1 A G 10: 86,694,042 F264L probably damaging Het
Id3 A G 4: 136,143,939 S21G possibly damaging Het
Ighe T A 12: 113,271,446 N365Y unknown Het
Il17rd T G 14: 27,099,958 M403R probably damaging Het
Ints10 A G 8: 68,796,713 probably benign Het
Kcnc4 T A 3: 107,445,427 probably null Het
Kctd19 A G 8: 105,387,879 S517P probably damaging Het
Lama5 A G 2: 180,180,151 F2964L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lrrc8e A G 8: 4,234,990 K405R probably benign Het
Lyst T A 13: 13,635,101 M452K possibly damaging Het
Mroh7 A G 4: 106,703,076 L677P probably benign Het
Mrps27 T A 13: 99,405,050 F221I probably benign Het
Nhlrc1 C T 13: 47,014,344 V146M probably damaging Het
Nlrp9b T A 7: 20,048,847 C895* probably null Het
Nod1 T C 6: 54,943,975 T453A probably benign Het
Nodal T C 10: 61,422,985 V67A probably damaging Het
Ntsr1 T C 2: 180,542,647 L381P probably damaging Het
Olfr1360 T A 13: 21,674,530 Q138L probably benign Het
Olfr272 T C 4: 52,910,996 D266G probably benign Het
Olfr311 T A 11: 58,841,651 M179K probably benign Het
P2ry14 T A 3: 59,115,265 K267M probably benign Het
Pcdh1 T C 18: 38,189,726 N1018S probably benign Het
Pkn3 G A 2: 30,084,691 V406I probably damaging Het
Prkcb C T 7: 122,627,693 T634I probably damaging Het
Psme2b T A 11: 48,945,382 probably null Het
Ptgfrn A G 3: 101,060,654 I541T probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapb T C 2: 158,465,826 V684A probably benign Het
Rbbp5 C T 1: 132,494,282 R307* probably null Het
Rcor1 T A 12: 111,103,603 probably benign Het
Rlbp1 C T 7: 79,380,060 A142T probably damaging Het
Rps6ka2 A G 17: 7,292,906 E581G probably null Het
Sars A T 3: 108,433,145 V155E probably benign Het
Sec31a G C 5: 100,375,319 P569A probably damaging Het
Selenof A T 3: 144,594,924 K111* probably null Het
Serpinb7 C T 1: 107,428,268 A7V possibly damaging Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Snrpa1 T A 7: 66,070,661 I204N probably damaging Het
Spry4 T G 18: 38,601,687 probably benign Het
Tcea2 A G 2: 181,686,958 N261S possibly damaging Het
Tmem59l A G 8: 70,485,154 F192S probably benign Het
Tnr T A 1: 159,850,105 I20N probably damaging Het
Ttll5 C T 12: 85,892,208 Q427* probably null Het
Vps45 C T 3: 96,048,346 A111T probably damaging Het
Zfp395 T C 14: 65,393,074 S358P probably benign Het
Zfp438 A G 18: 5,210,740 V766A probably benign Het
Other mutations in Caprin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Caprin2 APN 6 148843071 missense probably damaging 1.00
IGL01364:Caprin2 APN 6 148873028 missense probably benign 0.00
IGL02738:Caprin2 APN 6 148842862 missense probably damaging 1.00
IGL02819:Caprin2 APN 6 148848258 missense probably damaging 0.99
IGL03117:Caprin2 APN 6 148862466 missense possibly damaging 0.91
IGL03123:Caprin2 APN 6 148895007 missense probably damaging 1.00
IGL03378:Caprin2 APN 6 148877854 missense probably benign 0.23
R0242:Caprin2 UTSW 6 148842954 missense probably damaging 1.00
R0242:Caprin2 UTSW 6 148842954 missense probably damaging 1.00
R0621:Caprin2 UTSW 6 148858678 missense possibly damaging 0.94
R0930:Caprin2 UTSW 6 148883511 splice site probably null
R1591:Caprin2 UTSW 6 148873108 missense possibly damaging 0.94
R1763:Caprin2 UTSW 6 148843121 missense probably damaging 1.00
R1885:Caprin2 UTSW 6 148877885 splice site probably null
R2027:Caprin2 UTSW 6 148877887 missense probably damaging 0.98
R2867:Caprin2 UTSW 6 148846240 synonymous silent
R4856:Caprin2 UTSW 6 148873011 missense probably benign 0.19
R5580:Caprin2 UTSW 6 148858734 missense possibly damaging 0.79
R5696:Caprin2 UTSW 6 148877818 missense possibly damaging 0.49
R5765:Caprin2 UTSW 6 148843168 missense probably damaging 1.00
R5778:Caprin2 UTSW 6 148869322 missense probably benign
R5961:Caprin2 UTSW 6 148863540 missense probably damaging 1.00
R6255:Caprin2 UTSW 6 148877892 missense probably benign 0.28
R6440:Caprin2 UTSW 6 148869645 missense probably damaging 1.00
R6997:Caprin2 UTSW 6 148877976 missense probably damaging 1.00
R7034:Caprin2 UTSW 6 148848205 missense possibly damaging 0.64
R7344:Caprin2 UTSW 6 148873067 missense probably benign 0.02
R7632:Caprin2 UTSW 6 148883456 missense probably damaging 1.00
R7808:Caprin2 UTSW 6 148843030 missense probably damaging 1.00
R8075:Caprin2 UTSW 6 148869092 missense probably benign 0.03
R8083:Caprin2 UTSW 6 148842848 nonsense probably null
R8128:Caprin2 UTSW 6 148883442 splice site probably null
R8393:Caprin2 UTSW 6 148869152 missense probably benign 0.01
R8839:Caprin2 UTSW 6 148873027 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATCATTTCCCCAATGAATACAGCG -3'
(R):5'- ACTGCACTGGCAGCTTAAATCTTAGTC -3'

Sequencing Primer
(F):5'- AGCGTTGCCAGATATGTAAGTTC -3'
(R):5'- GGCAGCTTAAATCTTAGTCTGTTC -3'
Posted On2014-04-13