Mutagenetix > Incidental Mutation

Incidental Mutation 'R1631:Avil'

172806

Institutional Source

Beutler Lab

Gene Symbol

Avil

Ensembl Gene

ENSMUSG00000025432

Gene Name

advillin

Synonyms

DOC6

MMRRC Submission

039668-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R1631 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127000709-127020994 bp(+) (GRCm38)

Type of Mutation

splice site (4109 bp from exon)

DNA Base Change (assembly)

A to G at 127010625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000126816] [ENSMUST00000129173] [ENSMUST00000142698] [ENSMUST00000152054]

AlphaFold

O88398

Predicted Effect

probably benign
Transcript: ENSMUST00000026500
AA Change: N433S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: N433S

Domain	Start	End	E-Value	Type
GEL	14	111	9.44e-24	SMART
GEL	132	226	8.89e-20	SMART
GEL	253	346	1.19e-29	SMART
GEL	395	492	2.07e-29	SMART
GEL	512	598	4.01e-27	SMART
GEL	617	711	2.81e-31	SMART
VHP	784	819	1.31e-17	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000126816

SMART Domains

Protein: ENSMUSP00000115018
Gene: ENSMUSG00000025432

Domain	Start	End	E-Value	Type
Pfam:Gelsolin	23	78	4.4e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129173
AA Change: N433S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: N433S

Domain	Start	End	E-Value	Type
GEL	14	111	9.44e-24	SMART
GEL	132	226	8.89e-20	SMART
GEL	253	346	1.19e-29	SMART
GEL	395	492	2.07e-29	SMART
GEL	512	598	4.01e-27	SMART
GEL	617	711	2.81e-31	SMART
VHP	784	819	1.31e-17	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000142698

SMART Domains

Protein: ENSMUSP00000117667
Gene: ENSMUSG00000025432

Domain	Start	End	E-Value	Type
SCOP:d1d4xg_	5	53	2e-17	SMART
PDB:2VIL\|A	14	53	2e-14	PDB
Blast:GEL	14	54	7e-24	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152054

SMART Domains

Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

Domain	Start	End	E-Value	Type
Pfam:UBA	44	81	1.2e-10	PFAM
SCOP:d1efub4	101	120	5e-4	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933425L06Rik	C	A	13: 105,082,241	Q28K	probably benign	Het
Adamts10	T	A	17: 33,537,342	S320T	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Als2	T	C	1: 59,218,067	E12G	probably benign	Het
Arhgef10	A	T	8: 14,947,157	D321V	probably damaging	Het
Atp8a1	T	G	5: 67,749,052		probably null	Het
C2cd3	G	A	7: 100,372,497		probably null	Het
Col18a1	G	A	10: 77,059,297	P1177S	probably damaging	Het
Copb2	T	A	9: 98,580,160	F428L	probably benign	Het
Cpa1	A	G	6: 30,640,924	E138G	probably damaging	Het
Ctsm	T	C	13: 61,538,435	I12V	possibly damaging	Het
Dctn1	A	G	6: 83,197,596	Q967R	possibly damaging	Het
Dok2	T	C	14: 70,776,953	Y194H	probably damaging	Het
Ezh2	C	T	6: 47,577,658	M1I	probably null	Het
Fkbp8	T	A	8: 70,531,632	L210Q	probably damaging	Het
Fpr1	T	A	17: 17,877,001	Q242L	probably benign	Het
Gal3st2b	T	A	1: 93,940,783	D243E	probably damaging	Het
Gm281	C	T	14: 13,829,796	E649K	probably damaging	Het
Gm5422	A	G	10: 31,249,806		noncoding transcript	Het
Gucy1a2	A	G	9: 3,533,052	N84D	probably damaging	Het
Hsd3b5	A	C	3: 98,622,077	V79G	probably damaging	Het
Htr6	A	T	4: 139,061,493	V417E	probably benign	Het
Ifnar2	G	A	16: 91,391,867	V79I	probably benign	Het
Ighv10-1	T	C	12: 114,479,482		probably benign	Het
Itpr2	A	G	6: 146,180,290	F182L	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lama3	A	G	18: 12,407,494	Y285C	probably damaging	Het
Lamc2	C	A	1: 153,158,934	V108L	possibly damaging	Het
Lrrc14b	A	G	13: 74,361,254		probably null	Het
Magi3	T	C	3: 104,051,177	T531A	probably benign	Het
Mapre2	A	G	18: 23,832,954	Y32C	probably damaging	Het
Med1	C	T	11: 98,155,626		probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Olfr1351	A	T	10: 79,017,405	I28L	probably benign	Het
Olfr191	G	A	16: 59,086,045	T146I	probably benign	Het
Olfr516	A	C	7: 108,845,857	L51R	probably damaging	Het
Olfr555	A	G	7: 102,659,201	I127V	probably damaging	Het
Pde1b	A	G	15: 103,521,672	T143A	probably damaging	Het
Pkhd1	T	C	1: 20,522,897	D1664G	probably benign	Het
Plod3	C	T	5: 136,988,993	R208W	probably damaging	Het
Pstk	G	A	7: 131,384,542	A277T	possibly damaging	Het
Qrich1	T	C	9: 108,534,485	V403A	probably damaging	Het
Rad21	C	A	15: 51,970,040	V348F	probably damaging	Het
Sacs	T	A	14: 61,210,732	L3409*	probably null	Het
Setd4	T	A	16: 93,593,248	K98*	probably null	Het
Skint5	A	G	4: 113,483,926	V1385A	probably benign	Het
Stam	C	A	2: 14,146,248	S472*	probably null	Het
Stx2	A	G	5: 128,992,225	F141L	probably damaging	Het
Tia1	A	G	6: 86,420,348	D101G	probably damaging	Het
Ttc21a	T	A	9: 119,954,162		probably null	Het
Usp34	T	A	11: 23,460,651	N2700K	probably damaging	Het

Other mutations in Avil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Avil	APN	10	127017034	critical splice donor site	probably null
IGL01893:Avil	APN	10	127020546	missense	possibly damaging	0.73
IGL02127:Avil	APN	10	127011826	missense	probably benign	0.13
IGL02425:Avil	APN	10	127018447	missense	probably benign
IGL02458:Avil	APN	10	127016353	missense	probably benign	0.00
IGL02707:Avil	APN	10	127006562	missense	probably damaging	1.00
IGL02805:Avil	APN	10	127007617	missense	possibly damaging	0.79
IGL02836:Avil	APN	10	127008995	missense	probably damaging	1.00
IGL02961:Avil	APN	10	127008306	missense	probably benign	0.00
IGL03025:Avil	APN	10	127013577	missense	probably benign	0.19
IGL03083:Avil	APN	10	127016324	missense	probably benign	0.31
IGL03345:Avil	APN	10	127008957	unclassified	probably benign
IGL03365:Avil	APN	10	127010983	missense	probably damaging	1.00
R0109:Avil	UTSW	10	127013644	missense	probably benign
R0109:Avil	UTSW	10	127013644	missense	probably benign
R1159:Avil	UTSW	10	127011790	missense	possibly damaging	0.94
R2026:Avil	UTSW	10	127011873	missense	probably damaging	1.00
R3694:Avil	UTSW	10	127008330	missense	probably damaging	0.98
R3948:Avil	UTSW	10	127014205	missense	probably benign	0.00
R4165:Avil	UTSW	10	127006627	nonsense	probably null
R4978:Avil	UTSW	10	127018396	missense	probably benign	0.09
R5159:Avil	UTSW	10	127020448	critical splice acceptor site	probably null
R5254:Avil	UTSW	10	127011761	missense	probably benign	0.01
R5285:Avil	UTSW	10	127018459	missense	probably damaging	0.97
R5618:Avil	UTSW	10	127010577	missense	possibly damaging	0.79
R5682:Avil	UTSW	10	127014104	missense	probably damaging	1.00
R5786:Avil	UTSW	10	127016499	critical splice donor site	probably null
R5819:Avil	UTSW	10	127009998	missense	probably damaging	1.00
R6149:Avil	UTSW	10	127006582	missense	probably benign	0.25
R6631:Avil	UTSW	10	127007749	missense	possibly damaging	0.52
R6665:Avil	UTSW	10	127020525	missense	probably damaging	1.00
R6745:Avil	UTSW	10	127014119	missense	probably benign	0.00
R6804:Avil	UTSW	10	127008306	nonsense	probably null
R6838:Avil	UTSW	10	127013562	missense	probably benign
R7481:Avil	UTSW	10	127007591	missense	probably benign	0.33
R8213:Avil	UTSW	10	127008321	missense	probably damaging	0.97
R8349:Avil	UTSW	10	127009992	missense	probably benign	0.00
R8449:Avil	UTSW	10	127009992	missense	probably benign	0.00
R8510:Avil	UTSW	10	127009781	missense	probably benign	0.03
R8849:Avil	UTSW	10	127008792	missense	possibly damaging	0.91
R8944:Avil	UTSW	10	127010586	missense	probably damaging	1.00
R9101:Avil	UTSW	10	127017004	missense	probably benign	0.06
R9176:Avil	UTSW	10	127016379	missense	probably damaging	1.00
R9733:Avil	UTSW	10	127007842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCTGTTCAACATCGCCCAGTTC -3'
(R):5'- GGCTCCATCAAACTGCTGATCCAC -3'

Sequencing Primer
(F):5'- CCAGTTCCCTTCCAGTGG -3'
(R):5'- ACCACACGGAGCTTTTGC -3'

Posted On

2014-04-24