Mutagenetix > Incidental Mutation

Incidental Mutation 'R0109:Avil'

64213

Institutional Source

Beutler Lab

Gene Symbol

Avil

Ensembl Gene

ENSMUSG00000025432

Gene Name

advillin

Synonyms

DOC6

MMRRC Submission

038395-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R0109 (G1)

Quality Score

116

Status

Not validated

Chromosome

Chromosomal Location

127000709-127020994 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127013644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 603 (N603S)

Ref Sequence

ENSEMBL: ENSMUSP00000123405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000129173] [ENSMUST00000152054]

AlphaFold

O88398

Predicted Effect

probably benign
Transcript: ENSMUST00000026500
AA Change: N603S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: N603S

Domain	Start	End	E-Value	Type
GEL	14	111	9.44e-24	SMART
GEL	132	226	8.89e-20	SMART
GEL	253	346	1.19e-29	SMART
GEL	395	492	2.07e-29	SMART
GEL	512	598	4.01e-27	SMART
GEL	617	711	2.81e-31	SMART
VHP	784	819	1.31e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129173
AA Change: N603S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: N603S

Domain	Start	End	E-Value	Type
GEL	14	111	9.44e-24	SMART
GEL	132	226	8.89e-20	SMART
GEL	253	346	1.19e-29	SMART
GEL	395	492	2.07e-29	SMART
GEL	512	598	4.01e-27	SMART
GEL	617	711	2.81e-31	SMART
VHP	784	819	1.31e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000152054

SMART Domains

Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

Domain	Start	End	E-Value	Type
Pfam:UBA	44	81	1.2e-10	PFAM
SCOP:d1efub4	101	120	5e-4	SMART

Meta Mutation Damage Score

0.0619

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,318,762	K1496*	probably null	Het
Anapc1	C	A	2: 128,634,693	R1335L	probably damaging	Het
Arhgef10l	A	T	4: 140,578,294	S203T	probably benign	Het
Astn1	C	T	1: 158,664,104	T41I	possibly damaging	Het
Brca1	T	C	11: 101,531,090	D149G	possibly damaging	Het
Col19a1	A	C	1: 24,559,768		probably null	Het
Cps1	T	C	1: 67,229,418	V1435A	possibly damaging	Het
Cyp2j6	A	T	4: 96,518,157	I459N	probably damaging	Het
Cyth1	T	C	11: 118,182,306	E242G	probably damaging	Het
Dclk3	T	G	9: 111,467,670	L94R	possibly damaging	Het
Dsg3	T	C	18: 20,540,134	V954A	probably damaging	Het
Dync2h1	T	A	9: 7,111,487	D309V	probably damaging	Het
Efhd2	A	G	4: 141,874,567	F101L	probably benign	Het
Fgd5	T	A	6: 91,988,235	M325K	possibly damaging	Het
Fras1	T	C	5: 96,710,077	S2077P	probably benign	Het
Frmpd1	A	T	4: 45,279,340	E688D	probably benign	Het
Hspg2	T	C	4: 137,562,201	V3824A	probably benign	Het
Kctd16	A	G	18: 40,259,151	E264G	probably benign	Het
Mapk15	A	T	15: 75,996,077	K153*	probably null	Het
Miox	G	A	15: 89,335,581	V91I	probably benign	Het
Nfyb	G	A	10: 82,755,002	A65V	possibly damaging	Het
Olfr1241	A	G	2: 89,482,803	F111L	probably benign	Het
Olfr1442	C	A	19: 12,674,860	F218L	probably benign	Het
Olfr646	T	C	7: 104,106,605	S109P	probably damaging	Het
Parp9	T	C	16: 35,948,341	I64T	probably damaging	Het
Pfkfb4	T	C	9: 108,998,889	V43A	probably benign	Het
Pgap1	A	T	1: 54,494,825	V643E	probably damaging	Het
Pip5k1b	T	A	19: 24,379,047	M176L	probably benign	Het
Ppfia4	A	T	1: 134,324,217		probably null	Het
Prdx2	G	A	8: 84,970,251	G4S	probably benign	Het
Rin3	A	G	12: 102,313,081	I50V	possibly damaging	Het
Rtl1	G	A	12: 109,595,407		probably benign	Het
Sgsm3	G	C	15: 81,009,466	D434H	probably damaging	Het
Shank2	T	C	7: 144,410,577	S634P	possibly damaging	Het
Sik2	A	G	9: 50,899,475	M447T	possibly damaging	Het
Sla2	A	G	2: 156,883,587		probably null	Het
Spata16	T	A	3: 26,913,267	F389I	probably damaging	Het
Srebf1	G	A	11: 60,201,804	A793V	probably benign	Het
Tmed11	T	A	5: 108,777,412	D178V	probably damaging	Het
Traf7	A	G	17: 24,513,926	F110L	probably benign	Het
Ttn	T	A	2: 76,725,564	I30366F	probably damaging	Het
Ubqlnl	C	T	7: 104,150,192	V33M	probably damaging	Het
Vmn1r194	A	G	13: 22,245,047	Y278C	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r114	A	T	17: 23,310,575	Y184*	probably null	Het
Vmn2r53	C	T	7: 12,582,066	A609T	probably damaging	Het
Vps13b	A	G	15: 35,572,119	T961A	probably benign	Het
Xirp2	T	A	2: 67,519,278	N3272K	probably damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp454	T	A	11: 50,883,775	T24S	possibly damaging	Het

Other mutations in Avil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Avil	APN	10	127017034	critical splice donor site	probably null
IGL01893:Avil	APN	10	127020546	missense	possibly damaging	0.73
IGL02127:Avil	APN	10	127011826	missense	probably benign	0.13
IGL02425:Avil	APN	10	127018447	missense	probably benign
IGL02458:Avil	APN	10	127016353	missense	probably benign	0.00
IGL02707:Avil	APN	10	127006562	missense	probably damaging	1.00
IGL02805:Avil	APN	10	127007617	missense	possibly damaging	0.79
IGL02836:Avil	APN	10	127008995	missense	probably damaging	1.00
IGL02961:Avil	APN	10	127008306	missense	probably benign	0.00
IGL03025:Avil	APN	10	127013577	missense	probably benign	0.19
IGL03083:Avil	APN	10	127016324	missense	probably benign	0.31
IGL03345:Avil	APN	10	127008957	unclassified	probably benign
IGL03365:Avil	APN	10	127010983	missense	probably damaging	1.00
R0109:Avil	UTSW	10	127013644	missense	probably benign
R1159:Avil	UTSW	10	127011790	missense	possibly damaging	0.94
R1631:Avil	UTSW	10	127010625	splice site	probably null
R2026:Avil	UTSW	10	127011873	missense	probably damaging	1.00
R3694:Avil	UTSW	10	127008330	missense	probably damaging	0.98
R3948:Avil	UTSW	10	127014205	missense	probably benign	0.00
R4165:Avil	UTSW	10	127006627	nonsense	probably null
R4978:Avil	UTSW	10	127018396	missense	probably benign	0.09
R5159:Avil	UTSW	10	127020448	critical splice acceptor site	probably null
R5254:Avil	UTSW	10	127011761	missense	probably benign	0.01
R5285:Avil	UTSW	10	127018459	missense	probably damaging	0.97
R5618:Avil	UTSW	10	127010577	missense	possibly damaging	0.79
R5682:Avil	UTSW	10	127014104	missense	probably damaging	1.00
R5786:Avil	UTSW	10	127016499	critical splice donor site	probably null
R5819:Avil	UTSW	10	127009998	missense	probably damaging	1.00
R6149:Avil	UTSW	10	127006582	missense	probably benign	0.25
R6631:Avil	UTSW	10	127007749	missense	possibly damaging	0.52
R6665:Avil	UTSW	10	127020525	missense	probably damaging	1.00
R6745:Avil	UTSW	10	127014119	missense	probably benign	0.00
R6804:Avil	UTSW	10	127008306	nonsense	probably null
R6838:Avil	UTSW	10	127013562	missense	probably benign
R7481:Avil	UTSW	10	127007591	missense	probably benign	0.33
R8213:Avil	UTSW	10	127008321	missense	probably damaging	0.97
R8349:Avil	UTSW	10	127009992	missense	probably benign	0.00
R8449:Avil	UTSW	10	127009992	missense	probably benign	0.00
R8510:Avil	UTSW	10	127009781	missense	probably benign	0.03
R8849:Avil	UTSW	10	127008792	missense	possibly damaging	0.91
R8944:Avil	UTSW	10	127010586	missense	probably damaging	1.00
R9101:Avil	UTSW	10	127017004	missense	probably benign	0.06
R9176:Avil	UTSW	10	127016379	missense	probably damaging	1.00
R9733:Avil	UTSW	10	127007842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGTGCCCTGTGCCTCTAACACC -3'
(R):5'- TTGGAACACTCAAAGAGCCGGAC -3'

Sequencing Primer
(F):5'- GTGCCTCTAACACCTGTGTTC -3'
(R):5'- ctgttgtcacccccactc -3'

Posted On

2013-08-06