Mutagenetix > Incidental Mutation

Incidental Mutation 'R8213:Avil'

636269

Institutional Source

Beutler Lab

Gene Symbol

Avil

Ensembl Gene

ENSMUSG00000025432

Gene Name

advillin

Synonyms

DOC6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R8213 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127000709-127020994 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 127008321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 250 (I250F)

Ref Sequence

ENSEMBL: ENSMUSP00000026500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000126816] [ENSMUST00000129173] [ENSMUST00000142698] [ENSMUST00000152054]

AlphaFold

O88398

Predicted Effect

probably damaging
Transcript: ENSMUST00000026500
AA Change: I250F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: I250F

Domain	Start	End	E-Value	Type
GEL	14	111	9.44e-24	SMART
GEL	132	226	8.89e-20	SMART
GEL	253	346	1.19e-29	SMART
GEL	395	492	2.07e-29	SMART
GEL	512	598	4.01e-27	SMART
GEL	617	711	2.81e-31	SMART
VHP	784	819	1.31e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126816

SMART Domains

Protein: ENSMUSP00000115018
Gene: ENSMUSG00000025432

Domain	Start	End	E-Value	Type
Pfam:Gelsolin	23	78	4.4e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000129173
AA Change: I250F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: I250F

Domain	Start	End	E-Value	Type
GEL	14	111	9.44e-24	SMART
GEL	132	226	8.89e-20	SMART
GEL	253	346	1.19e-29	SMART
GEL	395	492	2.07e-29	SMART
GEL	512	598	4.01e-27	SMART
GEL	617	711	2.81e-31	SMART
VHP	784	819	1.31e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142698

SMART Domains

Protein: ENSMUSP00000117667
Gene: ENSMUSG00000025432

Domain	Start	End	E-Value	Type
SCOP:d1d4xg_	5	53	2e-17	SMART
PDB:2VIL\|A	14	53	2e-14	PDB
Blast:GEL	14	54	7e-24	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152054

SMART Domains

Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

Domain	Start	End	E-Value	Type
Pfam:UBA	44	81	1.2e-10	PFAM
SCOP:d1efub4	101	120	5e-4	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.1%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	C	15: 60,919,756	Y277C	probably damaging	Het
Acss1	T	A	2: 150,619,710	D651V	possibly damaging	Het
Aktip	G	T	8: 91,124,866	P243H	possibly damaging	Het
Arl11	T	G	14: 61,311,265	S175A	probably benign	Het
Aup1	A	G	6: 83,054,607		probably benign	Het
Btnl6	A	T	17: 34,508,883		probably null	Het
C77080	A	T	4: 129,221,459	V1070D	possibly damaging	Het
Ccdc7b	C	A	8: 129,178,291	Q137K	probably benign	Het
Cdk11b	G	A	4: 155,639,881	E319K	unknown	Het
Chka	A	C	19: 3,885,882	E196A	probably damaging	Het
Depdc5	C	T	5: 32,937,637	R753C	probably damaging	Het
Dhx57	T	A	17: 80,275,156	D340V	possibly damaging	Het
Dicer1	A	T	12: 104,702,693	D1243E	probably benign	Het
Dnajb9	A	T	12: 44,207,133	L164M	probably benign	Het
Dock6	A	G	9: 21,831,444	V785A	possibly damaging	Het
Efcab5	T	C	11: 77,116,071	Y909C	probably damaging	Het
Erp44	A	T	4: 48,208,783	S226T	probably benign	Het
Fgd6	A	T	10: 94,044,052	D256V	probably benign	Het
Fhl5	A	T	4: 25,207,113	Y218*	probably null	Het
Filip1	C	A	9: 79,818,092	A1082S	probably benign	Het
Gm13088	T	A	4: 143,654,185	M423L	probably benign	Het
Gm13128	A	T	4: 144,330,460	D71V	probably benign	Het
Heatr5a	G	A	12: 51,891,443	T1484M	probably damaging	Het
Herc1	G	T	9: 66,450,888	R2417L	probably damaging	Het
Hnrnpr	A	G	4: 136,317,175		probably benign	Het
Igsf5	A	T	16: 96,372,988	I73F	probably damaging	Het
Il17ra	T	C	6: 120,473,034	V91A	probably benign	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Kbtbd3	A	G	9: 4,331,269	K548E	probably damaging	Het
Kdm5d	T	A	Y: 941,515	C1239S	probably damaging	Het
Mamdc4	G	A	2: 25,566,356	T709M	probably benign	Het
Mybbp1a	T	A	11: 72,444,721	Y353N	probably damaging	Het
Nepn	A	T	10: 52,391,759	E40D	probably benign	Het
Npat	G	T	9: 53,570,570	E1193*	probably null	Het
Nrde2	G	A	12: 100,131,003	S846L	probably benign	Het
Nup205	T	C	6: 35,225,203	V1290A	probably benign	Het
Olfr1009	T	A	2: 85,721,501	L32Q	probably null	Het
Olfr1424	A	G	19: 12,059,092	V220A	probably benign	Het
Olfr517	C	A	7: 108,868,519	V212L	probably benign	Het
Pde6a	A	T	18: 61,220,696	K31M	possibly damaging	Het
Pms2	C	T	5: 143,914,771	R169C	probably damaging	Het
Polr2g	A	T	19: 8,798,257	L30Q	probably damaging	Het
Prdm15	T	A	16: 97,807,060	H679L	probably damaging	Het
Prl4a1	T	G	13: 28,023,386	Y214*	probably null	Het
Prlr	C	T	15: 10,329,242	T601M	possibly damaging	Het
Psen2	A	C	1: 180,245,691	S22A	probably benign	Het
Ralgapa1	C	A	12: 55,722,914	R764L	probably damaging	Het
Scgb2b11	T	C	7: 32,209,408	E89G	probably damaging	Het
Serpina10	T	C	12: 103,628,277	I228V	probably benign	Het
Serpinb1a	T	A	13: 32,842,999	H320L	probably damaging	Het
Sesn2	C	A	4: 132,498,053	Q267H	possibly damaging	Het
Sgsm1	A	T	5: 113,251,011	W1019R	probably damaging	Het
Sqle	A	G	15: 59,321,302		probably null	Het
Syt14	T	C	1: 192,986,829	M39V	probably benign	Het
Tgm7	A	G	2: 121,101,064	V206A	probably damaging	Het
Thbs4	T	C	13: 92,760,586		probably null	Het
Trpv1	T	C	11: 73,254,251	F721S	probably damaging	Het
Ttll10	A	T	4: 156,036,234	M433K	probably benign	Het
Vmn1r216	T	C	13: 23,099,525	I126T	probably benign	Het
Vmn2r108	G	A	17: 20,470,088	S494F	probably benign	Het
Vwa3b	C	T	1: 37,128,939	A603V	probably benign	Het
Xirp2	T	A	2: 67,476,866	N19K	probably damaging	Het
Zfp397	T	A	18: 23,960,722	N421K	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Avil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Avil	APN	10	127017034	critical splice donor site	probably null
IGL01893:Avil	APN	10	127020546	missense	possibly damaging	0.73
IGL02127:Avil	APN	10	127011826	missense	probably benign	0.13
IGL02425:Avil	APN	10	127018447	missense	probably benign
IGL02458:Avil	APN	10	127016353	missense	probably benign	0.00
IGL02707:Avil	APN	10	127006562	missense	probably damaging	1.00
IGL02805:Avil	APN	10	127007617	missense	possibly damaging	0.79
IGL02836:Avil	APN	10	127008995	missense	probably damaging	1.00
IGL02961:Avil	APN	10	127008306	missense	probably benign	0.00
IGL03025:Avil	APN	10	127013577	missense	probably benign	0.19
IGL03083:Avil	APN	10	127016324	missense	probably benign	0.31
IGL03345:Avil	APN	10	127008957	unclassified	probably benign
IGL03365:Avil	APN	10	127010983	missense	probably damaging	1.00
R0109:Avil	UTSW	10	127013644	missense	probably benign
R0109:Avil	UTSW	10	127013644	missense	probably benign
R1159:Avil	UTSW	10	127011790	missense	possibly damaging	0.94
R1631:Avil	UTSW	10	127010625	splice site	probably null
R2026:Avil	UTSW	10	127011873	missense	probably damaging	1.00
R3694:Avil	UTSW	10	127008330	missense	probably damaging	0.98
R3948:Avil	UTSW	10	127014205	missense	probably benign	0.00
R4165:Avil	UTSW	10	127006627	nonsense	probably null
R4978:Avil	UTSW	10	127018396	missense	probably benign	0.09
R5159:Avil	UTSW	10	127020448	critical splice acceptor site	probably null
R5254:Avil	UTSW	10	127011761	missense	probably benign	0.01
R5285:Avil	UTSW	10	127018459	missense	probably damaging	0.97
R5618:Avil	UTSW	10	127010577	missense	possibly damaging	0.79
R5682:Avil	UTSW	10	127014104	missense	probably damaging	1.00
R5786:Avil	UTSW	10	127016499	critical splice donor site	probably null
R5819:Avil	UTSW	10	127009998	missense	probably damaging	1.00
R6149:Avil	UTSW	10	127006582	missense	probably benign	0.25
R6631:Avil	UTSW	10	127007749	missense	possibly damaging	0.52
R6665:Avil	UTSW	10	127020525	missense	probably damaging	1.00
R6745:Avil	UTSW	10	127014119	missense	probably benign	0.00
R6804:Avil	UTSW	10	127008306	nonsense	probably null
R6838:Avil	UTSW	10	127013562	missense	probably benign
R7481:Avil	UTSW	10	127007591	missense	probably benign	0.33
R8349:Avil	UTSW	10	127009992	missense	probably benign	0.00
R8449:Avil	UTSW	10	127009992	missense	probably benign	0.00
R8510:Avil	UTSW	10	127009781	missense	probably benign	0.03
R8849:Avil	UTSW	10	127008792	missense	possibly damaging	0.91
R8944:Avil	UTSW	10	127010586	missense	probably damaging	1.00
R9101:Avil	UTSW	10	127017004	missense	probably benign	0.06
R9176:Avil	UTSW	10	127016379	missense	probably damaging	1.00
R9733:Avil	UTSW	10	127007842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTGGCAAAGGACATTCGG -3'
(R):5'- AGAAAGGTTCTACCCGCAGG -3'

Sequencing Primer
(F):5'- CATTCGGGACAGGGAGCG -3'
(R):5'- AGGATAGCTGCCTCTCTGAG -3'

Posted On

2020-07-13